EMAIL THIS PAGE TO A FRIEND

GPR123

G protein-coupled receptor 123

UniProtKB ID: Q86SQ6, A5HL16, A6NG50, Q5T234, Q86SN7, Q96JJ9
Gene ID:
Mouse(52389) G protein-coupled receptor 123
Rat(309097) G protein-coupled receptor 123
chicken(423825) G protein-coupled receptor 123
dog(491412) G protein-coupled receptor 123
cow(518385) G protein-coupled receptor 123
domestic guinea pig(100727635) G protein-coupled receptor 123
naked mole-rat(101703528) G protein-coupled receptor 123
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001083909 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001083909 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001083909 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177469 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177469 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177469 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032422 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032422 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032422 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001083909 Rosetta Predictions human pricing
NM_032422 Rosetta Predictions human pricing
NM_001107559 Rosetta Predictions rat pricing
NM_177469 Rosetta Predictions mouse pricing
XM_486019 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083909 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317271 predicted 1322
2 SASI_Hs02_00317272 predicted 722
3 SASI_Hs02_00317273 predicted 884
4 SASI_Hs02_00317274 predicted 648
5 SASI_Hs02_00317275 predicted 1678
6 SASI_Hs02_00317276 predicted 2005
7 SASI_Hs02_00317277 predicted 644
8 SASI_Hs02_00317278 predicted 632
9 SASI_Hs02_00317279 predicted 1057
10 SASI_Hs02_00317280 predicted 735
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032422 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227219 predicted 464
2 SASI_Hs01_00227220 predicted 3051
3 SASI_Hs01_00227221 predicted 2075
4 SASI_Hs01_00227222 predicted 249
5 SASI_Hs01_00227223 predicted 2454
6 SASI_Hs01_00227224 predicted 2616
7 SASI_Hs01_00227225 predicted 509
8 SASI_Hs01_00227226 predicted 1262
9 SASI_Hs01_00227227 predicted 2361
10 SASI_Hs01_00227228 predicted 2781
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107559 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230025 predicted 1567
2 SASI_Rn02_00230026 predicted 2064
3 SASI_Rn02_00230027 predicted 2702
4 SASI_Rn02_00230028 predicted 1585
5 SASI_Rn02_00230029 predicted 1575
6 SASI_Rn02_00230030 predicted 1963
7 SASI_Rn02_00230031 predicted 3002
8 SASI_Rn02_00230032 predicted 2020
9 SASI_Rn02_00230033 predicted 2693
10 SASI_Rn02_00230034 predicted 1808
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177469 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347672 predicted 2445
2 SASI_Mm02_00347673 predicted 1277
3 SASI_Mm02_00347674 predicted 1900
4 SASI_Mm02_00347675 predicted 2194
5 SASI_Mm02_00347676 predicted 2755
6 SASI_Mm02_00347677 predicted 1317
7 SASI_Mm02_00347678 predicted 1398
8 SASI_Mm02_00347679 predicted 2310
9 SASI_Mm02_00347680 predicted 2563
10 SASI_Mm02_00347681 predicted 2793
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_486019 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00247425 predicted 2454
2 SASI_Mm01_00247426 predicted 1341
3 SASI_Mm01_00247427 predicted 1280
4 SASI_Mm01_00247428 predicted 2200
5 SASI_Mm01_00247429 predicted 1332
6 SASI_Mm01_00247430 predicted 1409
7 SASI_Mm01_00247431 predicted 1217
8 SASI_Mm01_00247432 predicted 1325
9 SASI_Mm01_00247433 predicted 1344
10 SASI_Mm01_00247434 predicted 1432
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001083909
GPR123 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 123
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000358290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001083909.1-2590s21c1
Sequence:CCGGGACCTTTCCCAGTGTTCAATGCTCGAGCATTGAACACTGGGAAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083909.1-1172s21c1
Sequence:CCGGCTGCAGAACGAGCACTCATTCCTCGAGGAATGAGTGCTCGTTCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083909.1-693s21c1
Sequence:CCGGTGGGCATCGTGCTGCACTATTCTCGAGAATAGTGCAGCACGATGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083909.1-1682s21c1
Sequence:CCGGTGCCTTCAGGGCAGAACTAAGCTCGAGCTTAGTTCTGCCCTGAAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001083909
GPR123 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 123
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000358290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001083909.1-2590s21c1
Sequence:CCGGGACCTTTCCCAGTGTTCAATGCTCGAGCATTGAACACTGGGAAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083909.1-1172s21c1
Sequence:CCGGCTGCAGAACGAGCACTCATTCCTCGAGGAATGAGTGCTCGTTCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083909.1-693s21c1
Sequence:CCGGTGGGCATCGTGCTGCACTATTCTCGAGAATAGTGCAGCACGATGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083909.1-1682s21c1
Sequence:CCGGTGCCTTCAGGGCAGAACTAAGCTCGAGCTTAGTTCTGCCCTGAAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001083909
GPR123 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 123
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000358290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001083909.1-2590s21c1
Sequence:CCGGGACCTTTCCCAGTGTTCAATGCTCGAGCATTGAACACTGGGAAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083909.1-1172s21c1
Sequence:CCGGCTGCAGAACGAGCACTCATTCCTCGAGGAATGAGTGCTCGTTCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083909.1-693s21c1
Sequence:CCGGTGGGCATCGTGCTGCACTATTCTCGAGAATAGTGCAGCACGATGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083909.1-1682s21c1
Sequence:CCGGTGCCTTCAGGGCAGAACTAAGCTCGAGCTTAGTTCTGCCCTGAAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177469
GPR123 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 123
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177469.3-2327s1c1
Sequence:CCGGGATGCACTGTGAGCAGTTAATCTCGAGATTAACTGCTCACAGTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177469.3-1394s21c1
Sequence:CCGGGGGCATTGCTCTGCACTATTCCTCGAGGAATAGTGCAGAGCAATGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177469.3-2033s21c1
Sequence:CCGGACTGGGACTCTTTGTACTTATCTCGAGATAAGTACAAAGAGTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177469.3-2785s21c1
Sequence:CCGGTTCGAGAAGGCCTGCCATTTGCTCGAGCAAATGGCAGGCCTTCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177469.3-1261s21c1
Sequence:CCGGATCAGAGTGCCATCCGGATAACTCGAGTTATCCGGATGGCACTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177469.3-3181s21c1
Sequence:CCGGGTTCTTGCCTTTGGTATATATCTCGAGATATATACCAAAGGCAAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177469.2-1150s1c1
Sequence:CCGGGCTGCCACAAACATCAGAAATCTCGAGATTTCTGATGTTTGTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177469.2-1008s1c1
Sequence:CCGGGACTGCTAGGAACATCTACAACTCGAGTTGTAGATGTTCCTAGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173993    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177469.2-1443s1c1
Sequence:CCGGGCAGAACGAGCATTCCTTCAACTCGAGTTGAAGGAATGCTCGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177469
GPR123 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 123
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177469.3-2327s1c1
Sequence:CCGGGATGCACTGTGAGCAGTTAATCTCGAGATTAACTGCTCACAGTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177469.3-1394s21c1
Sequence:CCGGGGGCATTGCTCTGCACTATTCCTCGAGGAATAGTGCAGAGCAATGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177469.3-2033s21c1
Sequence:CCGGACTGGGACTCTTTGTACTTATCTCGAGATAAGTACAAAGAGTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177469.3-2785s21c1
Sequence:CCGGTTCGAGAAGGCCTGCCATTTGCTCGAGCAAATGGCAGGCCTTCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177469.3-1261s21c1
Sequence:CCGGATCAGAGTGCCATCCGGATAACTCGAGTTATCCGGATGGCACTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177469.3-3181s21c1
Sequence:CCGGGTTCTTGCCTTTGGTATATATCTCGAGATATATACCAAAGGCAAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177469.2-1150s1c1
Sequence:CCGGGCTGCCACAAACATCAGAAATCTCGAGATTTCTGATGTTTGTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177469.2-1008s1c1
Sequence:CCGGGACTGCTAGGAACATCTACAACTCGAGTTGTAGATGTTCCTAGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173993    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177469.2-1443s1c1
Sequence:CCGGGCAGAACGAGCATTCCTTCAACTCGAGTTGAAGGAATGCTCGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177469
GPR123 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 123
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177469.3-2327s1c1
Sequence:CCGGGATGCACTGTGAGCAGTTAATCTCGAGATTAACTGCTCACAGTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177469.3-1394s21c1
Sequence:CCGGGGGCATTGCTCTGCACTATTCCTCGAGGAATAGTGCAGAGCAATGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177469.3-2033s21c1
Sequence:CCGGACTGGGACTCTTTGTACTTATCTCGAGATAAGTACAAAGAGTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177469.3-2785s21c1
Sequence:CCGGTTCGAGAAGGCCTGCCATTTGCTCGAGCAAATGGCAGGCCTTCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177469.3-1261s21c1
Sequence:CCGGATCAGAGTGCCATCCGGATAACTCGAGTTATCCGGATGGCACTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177469.3-3181s21c1
Sequence:CCGGGTTCTTGCCTTTGGTATATATCTCGAGATATATACCAAAGGCAAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177469.2-1150s1c1
Sequence:CCGGGCTGCCACAAACATCAGAAATCTCGAGATTTCTGATGTTTGTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177469.2-1008s1c1
Sequence:CCGGGACTGCTAGGAACATCTACAACTCGAGTTGTAGATGTTCCTAGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173993    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177469.2-1443s1c1
Sequence:CCGGGCAGAACGAGCATTCCTTCAACTCGAGTTGAAGGAATGCTCGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032422
GPR123 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 123
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032422.1-466s1c1
Sequence:CCGGCCGACTTTCCTAGGCAACAAACTCGAGTTTGTTGCCTAGGAAAGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032422.1-1818s1c1
Sequence:CCGGGACACCTCACTGTGTAGGAAACTCGAGTTTCCTACACAGTGAGGTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032422.1-2613s1c1
Sequence:CCGGTGCCACGAACATCAGGAATTACTCGAGTAATTCCTGATGTTCGTGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032422.1-3048s1c1
Sequence:CCGGCCTGGGACTCTTCGTGCTCATCTCGAGATGAGCACGAAGAGTCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032422.1-1114s1c1
Sequence:CCGGCCTGCCTTCTTTCAATACCCTCTCGAGAGGGTATTGAAAGAAGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032422
GPR123 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 123
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032422.1-466s1c1
Sequence:CCGGCCGACTTTCCTAGGCAACAAACTCGAGTTTGTTGCCTAGGAAAGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032422.1-1818s1c1
Sequence:CCGGGACACCTCACTGTGTAGGAAACTCGAGTTTCCTACACAGTGAGGTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032422.1-2613s1c1
Sequence:CCGGTGCCACGAACATCAGGAATTACTCGAGTAATTCCTGATGTTCGTGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032422.1-3048s1c1
Sequence:CCGGCCTGGGACTCTTCGTGCTCATCTCGAGATGAGCACGAAGAGTCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032422.1-1114s1c1
Sequence:CCGGCCTGCCTTCTTTCAATACCCTCTCGAGAGGGTATTGAAAGAAGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032422
GPR123 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 123
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032422.1-466s1c1
Sequence:CCGGCCGACTTTCCTAGGCAACAAACTCGAGTTTGTTGCCTAGGAAAGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032422.1-1818s1c1
Sequence:CCGGGACACCTCACTGTGTAGGAAACTCGAGTTTCCTACACAGTGAGGTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032422.1-2613s1c1
Sequence:CCGGTGCCACGAACATCAGGAATTACTCGAGTAATTCCTGATGTTCGTGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032422.1-3048s1c1
Sequence:CCGGCCTGGGACTCTTCGTGCTCATCTCGAGATGAGCACGAAGAGTCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032422.1-1114s1c1
Sequence:CCGGCCTGCCTTCTTTCAATACCCTCTCGAGAGGGTATTGAAAGAAGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks