EMAIL THIS PAGE TO A FRIEND

GPR124

G protein-coupled receptor 124

Synonyms: TEM5
Gene ID:
Mouse(78560) G protein-coupled receptor 124
Rat(306543) G protein-coupled receptor 124
sheep(101117990) G protein-coupled receptor 124
domestic guinea pig(100734026) G protein-coupled receptor 124
naked mole-rat(101713154) G protein-coupled receptor 124
Zebrafish(560700) G protein-coupled receptor 124
Horse(100059646) G protein-coupled receptor 124
domestic cat(101099958) G protein-coupled receptor 124
dog(482853) G protein-coupled receptor 124
chicken(426771) G protein-coupled receptor 124
76 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_054044 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_054044 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_054044 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032777 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032777 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032777 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032777 Rosetta Predictions human pricing
XM_240449 Rosetta Predictions rat pricing
NM_054044 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032777 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014884 predicted 553
2 SASI_Hs01_00014885 predicted 2431
3 SASI_Hs01_00014886 predicted 2815
4 SASI_Hs01_00014887 predicted 2716
5 SASI_Hs01_00014888 predicted 489
6 SASI_Hs01_00014889 predicted 1651
7 SASI_Hs01_00014890 predicted 2249
8 SASI_Hs01_00014891 predicted 2655
9 SASI_Hs01_00014892 predicted 1952
10 SASI_Hs02_00360323 predicted 1636
11 SASI_Hs01_00014893 predicted 1886
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_240449 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00131851 predicted 2893
2 SASI_Rn01_00131852 predicted 1189
3 SASI_Rn01_00131853 predicted 2875
4 SASI_Rn01_00131854 predicted 582
5 SASI_Rn01_00131855 predicted 1943
6 SASI_Rn01_00131856 predicted 4633
7 SASI_Rn01_00131857 predicted 2189
8 SASI_Rn01_00131858 predicted 2307
9 SASI_Rn01_00131859 predicted 749
10 SASI_Rn01_00131860 predicted 1280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054044 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147170 predicted 1862
2 SASI_Mm01_00147171 predicted 510
3 SASI_Mm01_00147172 predicted 1116
4 SASI_Mm01_00147173 predicted 2332
5 SASI_Mm01_00147174 predicted 4021
6 SASI_Mm01_00147175 predicted 3861
7 SASI_Mm01_00147176 predicted 3620
8 SASI_Mm01_00147177 predicted 2901
9 SASI_Mm01_00147178 predicted 3982
10 SASI_Mm02_00337951 predicted 1013
11 SASI_Mm01_00147179 predicted 1749
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054044
VALIDATED
GPR124 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 124
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_054044.1-570s1c1
Sequence:CCGGCCCTAGACTTCTCAGACTAAACTCGAGTTTAGTCTGAGAAGTCTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_054044.1-2523s1c1
Sequence:CCGGGCTGAACCTTTGTTTCCATATCTCGAGATATGGAAACAAAGGTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_054044.1-4979s1c1
Sequence:CCGGGCCATGCTAATAATCTGACTTCTCGAGAAGTCAGATTATTAGCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_054044.1-2907s1c1
Sequence:CCGGGCCTATCACCTGGATCTACTTCTCGAGAAGTAGATCCAGGTGATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_054044.1-3986s1c1
Sequence:CCGGCGCTCAACACTACCAGTCTTACTCGAGTAAGACTGGTAGTGTTGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054044.1-2523s21c1
Sequence:CCGGGCTGAACCTTTGTTTCCATATCTCGAGATATGGAAACAAAGGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054044.1-2907s21c1
Sequence:CCGGGCCTATCACCTGGATCTACTTCTCGAGAAGTAGATCCAGGTGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054044.1-570s21c1
Sequence:CCGGCCCTAGACTTCTCAGACTAAACTCGAGTTTAGTCTGAGAAGTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054044.1-3986s21c1
Sequence:CCGGCGCTCAACACTACCAGTCTTACTCGAGTAAGACTGGTAGTGTTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054044.1-4979s21c1
Sequence:CCGGGCCATGCTAATAATCTGACTTCTCGAGAAGTCAGATTATTAGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054044
VALIDATED
GPR124 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 124
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_054044.1-570s1c1
Sequence:CCGGCCCTAGACTTCTCAGACTAAACTCGAGTTTAGTCTGAGAAGTCTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_054044.1-2523s1c1
Sequence:CCGGGCTGAACCTTTGTTTCCATATCTCGAGATATGGAAACAAAGGTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_054044.1-4979s1c1
Sequence:CCGGGCCATGCTAATAATCTGACTTCTCGAGAAGTCAGATTATTAGCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_054044.1-2907s1c1
Sequence:CCGGGCCTATCACCTGGATCTACTTCTCGAGAAGTAGATCCAGGTGATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_054044.1-3986s1c1
Sequence:CCGGCGCTCAACACTACCAGTCTTACTCGAGTAAGACTGGTAGTGTTGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054044.1-2523s21c1
Sequence:CCGGGCTGAACCTTTGTTTCCATATCTCGAGATATGGAAACAAAGGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054044.1-2907s21c1
Sequence:CCGGGCCTATCACCTGGATCTACTTCTCGAGAAGTAGATCCAGGTGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054044.1-570s21c1
Sequence:CCGGCCCTAGACTTCTCAGACTAAACTCGAGTTTAGTCTGAGAAGTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054044.1-3986s21c1
Sequence:CCGGCGCTCAACACTACCAGTCTTACTCGAGTAAGACTGGTAGTGTTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054044.1-4979s21c1
Sequence:CCGGGCCATGCTAATAATCTGACTTCTCGAGAAGTCAGATTATTAGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054044
VALIDATED
GPR124 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 124
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_054044.1-570s1c1
Sequence:CCGGCCCTAGACTTCTCAGACTAAACTCGAGTTTAGTCTGAGAAGTCTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_054044.1-2523s1c1
Sequence:CCGGGCTGAACCTTTGTTTCCATATCTCGAGATATGGAAACAAAGGTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_054044.1-4979s1c1
Sequence:CCGGGCCATGCTAATAATCTGACTTCTCGAGAAGTCAGATTATTAGCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_054044.1-2907s1c1
Sequence:CCGGGCCTATCACCTGGATCTACTTCTCGAGAAGTAGATCCAGGTGATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_054044.1-3986s1c1
Sequence:CCGGCGCTCAACACTACCAGTCTTACTCGAGTAAGACTGGTAGTGTTGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054044.1-2523s21c1
Sequence:CCGGGCTGAACCTTTGTTTCCATATCTCGAGATATGGAAACAAAGGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054044.1-2907s21c1
Sequence:CCGGGCCTATCACCTGGATCTACTTCTCGAGAAGTAGATCCAGGTGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054044.1-570s21c1
Sequence:CCGGCCCTAGACTTCTCAGACTAAACTCGAGTTTAGTCTGAGAAGTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054044.1-3986s21c1
Sequence:CCGGCGCTCAACACTACCAGTCTTACTCGAGTAAGACTGGTAGTGTTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054044.1-4979s21c1
Sequence:CCGGGCCATGCTAATAATCTGACTTCTCGAGAAGTCAGATTATTAGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032777
GPR124 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 124
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032777.6-5400s1c1
Sequence:CCGGGCACAGACATATTAGAAGAAACTCGAGTTTCTTCTAATATGTCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032777.6-2669s1c1
Sequence:CCGGCGGTTCTATTTGATCGCTGGACTCGAGTCCAGCGATCAAATAGAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032777.6-2437s1c1
Sequence:CCGGGCTGAACTTGTGCTTCCACATCTCGAGATGTGGAAGCACAAGTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032777.6-277s1c1
Sequence:CCGGCCTGCTCTTGAGCAATAACAACTCGAGTTGTTATTGCTCAAGAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032777.6-490s1c1
Sequence:CCGGCCGACTAAACATATCTGGAAACTCGAGTTTCCAGATATGTTTAGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357191    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032777.7-4562s21c1
Sequence:CCGGATCCCAGAAACACGCATAATACTCGAGTATTATGCGTGTTTCTGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032777.7-1787s21c1
Sequence:CCGGGTTATGTCGACCAGATCAAAGCTCGAGCTTTGATCTGGTCGACATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032777.7-4361s21c1
Sequence:CCGGAGAGCGAAACTACCGTCTAAGCTCGAGCTTAGACGGTAGTTTCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032777.7-3171s21c1
Sequence:CCGGGCTCATCACCTGGATCTATTTCTCGAGAAATAGATCCAGGTGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032777
GPR124 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 124
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032777.6-5400s1c1
Sequence:CCGGGCACAGACATATTAGAAGAAACTCGAGTTTCTTCTAATATGTCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032777.6-2669s1c1
Sequence:CCGGCGGTTCTATTTGATCGCTGGACTCGAGTCCAGCGATCAAATAGAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032777.6-2437s1c1
Sequence:CCGGGCTGAACTTGTGCTTCCACATCTCGAGATGTGGAAGCACAAGTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032777.6-277s1c1
Sequence:CCGGCCTGCTCTTGAGCAATAACAACTCGAGTTGTTATTGCTCAAGAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032777.6-490s1c1
Sequence:CCGGCCGACTAAACATATCTGGAAACTCGAGTTTCCAGATATGTTTAGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357191    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032777.7-4562s21c1
Sequence:CCGGATCCCAGAAACACGCATAATACTCGAGTATTATGCGTGTTTCTGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032777.7-1787s21c1
Sequence:CCGGGTTATGTCGACCAGATCAAAGCTCGAGCTTTGATCTGGTCGACATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032777.7-4361s21c1
Sequence:CCGGAGAGCGAAACTACCGTCTAAGCTCGAGCTTAGACGGTAGTTTCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032777.7-3171s21c1
Sequence:CCGGGCTCATCACCTGGATCTATTTCTCGAGAAATAGATCCAGGTGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032777
GPR124 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 124
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032777.6-5400s1c1
Sequence:CCGGGCACAGACATATTAGAAGAAACTCGAGTTTCTTCTAATATGTCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032777.6-2669s1c1
Sequence:CCGGCGGTTCTATTTGATCGCTGGACTCGAGTCCAGCGATCAAATAGAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032777.6-2437s1c1
Sequence:CCGGGCTGAACTTGTGCTTCCACATCTCGAGATGTGGAAGCACAAGTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032777.6-277s1c1
Sequence:CCGGCCTGCTCTTGAGCAATAACAACTCGAGTTGTTATTGCTCAAGAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032777.6-490s1c1
Sequence:CCGGCCGACTAAACATATCTGGAAACTCGAGTTTCCAGATATGTTTAGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357191    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032777.7-4562s21c1
Sequence:CCGGATCCCAGAAACACGCATAATACTCGAGTATTATGCGTGTTTCTGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032777.7-1787s21c1
Sequence:CCGGGTTATGTCGACCAGATCAAAGCTCGAGCTTTGATCTGGTCGACATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032777.7-4361s21c1
Sequence:CCGGAGAGCGAAACTACCGTCTAAGCTCGAGCTTAGACGGTAGTTTCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032777.7-3171s21c1
Sequence:CCGGGCTCATCACCTGGATCTATTTCTCGAGAAATAGATCCAGGTGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks