EMAIL THIS PAGE TO A FRIEND

GPR125

G protein-coupled receptor 125

81 Gene Product Result for
Synonyms: PGR21 TEM5L
UniProtKB ID: Q8IWK6, Q6UXK9, Q86SQ5, Q8TC55
Gene ID:
Human(166647) Summary: This gene encodes a member of the G protein-coupled receptor superfamily. This membrane protein may play a role in tumor angiogenesis through its interaction with the human homolog of the Drosophila disc large tumor suppressor gene. This gene is mapped to a candidate region of chromosome 4 which may be associated with bipolar disorder and schizophrenia. [provided by RefSeq, Oct 2012]
Mouse(70693) G protein-coupled receptor 125
Rat(305408) G protein-coupled receptor 125
chicken(422817) G protein-coupled receptor 125
cow(541147) G protein-coupled receptor 125
dog(488859) G protein-coupled receptor 125
Horse(100068039) G protein-coupled receptor 125
domestic cat(101082650) G protein-coupled receptor 125
domestic guinea pig(100719315) G protein-coupled receptor 125
naked mole-rat(101705377) G protein-coupled receptor 125
sheep(101102902) G protein-coupled receptor 125
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_132089 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_132089 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_132089 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145290 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145290 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145290 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145290 Rosetta Predictions human pricing
NM_001107218 Rosetta Predictions rat pricing
XM_132089 Rosetta Predictions mouse pricing
XM_991709 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145290 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365173 predicted 4104
2 SASI_Hs02_00365174 predicted 1099
3 SASI_Hs01_00245643 predicted 2146
4 SASI_Hs01_00245644 predicted 2410
5 SASI_Hs01_00245645 predicted 2957
6 SASI_Hs01_00245646 predicted 2746
7 SASI_Hs01_00245647 predicted 3139
8 SASI_Hs01_00245648 predicted 4176
9 SASI_Hs02_00365175 predicted 1794
10 SASI_Hs01_00245649 predicted 3730
11 SASI_Hs01_00245642 predicted 1854
12 SASI_Hs01_00245650 predicted 3366
13 SASI_Hs01_00245651 predicted 3260
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107218 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226675 predicted 300
2 SASI_Rn02_00226676 predicted 369
3 SASI_Rn02_00226677 predicted 412
4 SASI_Rn02_00226678 predicted 419
5 SASI_Rn02_00226679 predicted 377
6 SASI_Rn02_00226680 predicted 346
7 SASI_Rn02_00226681 predicted 358
8 SASI_Rn02_00226682 predicted 288
9 SASI_Rn02_00226683 predicted 309
10 SASI_Rn02_00226684 predicted 346
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_132089 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00272803 predicted 2040
2 SASI_Mm02_00424458 predicted 3943
3 SASI_Mm02_00424459 predicted 1390
4 SASI_Mm01_00272804 predicted 3627
5 SASI_Mm01_00272806 predicted 1205
6 SASI_Mm01_00272807 predicted 1227
7 SASI_Mm01_00272808 predicted 1531
8 SASI_Mm01_00272810 predicted 1415
9 SASI_Mm01_00272811 predicted 2493
10 SASI_Mm01_00272812 predicted 991
11 SASI_Mm01_00272805 predicted 3263
12 SASI_Mm01_00272809 predicted 4321
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_991709 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00450834 predicted 1678
2 SASI_Mm02_00450835 predicted 3581
3 SASI_Mm02_00450836 predicted 1023
4 SASI_Mm02_00450837 predicted 3261
5 SASI_Mm02_00450838 predicted 843
6 SASI_Mm02_00450839 predicted 862
7 SASI_Mm02_00450840 predicted 1165
8 SASI_Mm02_00450841 predicted 1054
9 SASI_Mm02_00450842 predicted 2133
10 SASI_Mm02_00450843 predicted 629
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_132089
GPR125 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 125
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238969    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_132089.7-4475s21c1
Sequence:CCGGAGCTTTGGGATTTACTTATTTCTCGAGAAATAAGTAAATCCCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_132089.7-3818s21c1
Sequence:CCGGACTCGATGGACAACGATATTACTCGAGTAATATCGTTGTCCATCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_132089.7-716s21c1
Sequence:CCGGACCTCCGGAACAACCTTATTACTCGAGTAATAAGGTTGTTCCGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_132089.7-3214s21c1
Sequence:CCGGAGACACCCTGAGCGCAAATATCTCGAGATATTTGCGCTCAGGGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_132089.7-4039s21c1
Sequence:CCGGAGGAGTAGGAGAGCTTATTTACTCGAGTAAATAAGCTCTCCTACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_132089
GPR125 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 125
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238969    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_132089.7-4475s21c1
Sequence:CCGGAGCTTTGGGATTTACTTATTTCTCGAGAAATAAGTAAATCCCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_132089.7-3818s21c1
Sequence:CCGGACTCGATGGACAACGATATTACTCGAGTAATATCGTTGTCCATCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_132089.7-716s21c1
Sequence:CCGGACCTCCGGAACAACCTTATTACTCGAGTAATAAGGTTGTTCCGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_132089.7-3214s21c1
Sequence:CCGGAGACACCCTGAGCGCAAATATCTCGAGATATTTGCGCTCAGGGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_132089.7-4039s21c1
Sequence:CCGGAGGAGTAGGAGAGCTTATTTACTCGAGTAAATAAGCTCTCCTACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_132089
GPR125 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 125
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238969    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_132089.7-4475s21c1
Sequence:CCGGAGCTTTGGGATTTACTTATTTCTCGAGAAATAAGTAAATCCCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_132089.7-3818s21c1
Sequence:CCGGACTCGATGGACAACGATATTACTCGAGTAATATCGTTGTCCATCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_132089.7-716s21c1
Sequence:CCGGACCTCCGGAACAACCTTATTACTCGAGTAATAAGGTTGTTCCGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_132089.7-3214s21c1
Sequence:CCGGAGACACCCTGAGCGCAAATATCTCGAGATATTTGCGCTCAGGGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_132089.7-4039s21c1
Sequence:CCGGAGGAGTAGGAGAGCTTATTTACTCGAGTAAATAAGCTCTCCTACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145290
GPR125 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 125
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145290.2-1959s1c1
Sequence:CCGGCCTCTGATCGTACAGGACTTTCTCGAGAAAGTCCTGTACGATCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137426    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145290.2-1733s1c1
Sequence:CCGGGCAAGTAACATCATGTTGGCTCTCGAGAGCCAACATGATGTTACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145290.2-3261s1c1
Sequence:CCGGCCAGCCTTACTTTGCTCTTATCTCGAGATAAGAGCAAAGTAAGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145290.2-3731s1c1
Sequence:CCGGGCGCCTTTAGAAGTTCAGTTTCTCGAGAAACTGAACTTCTAAAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135417    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145290.2-4269s1c1
Sequence:CCGGGTGATACTCACATTCCTTGAACTCGAGTTCAAGGAATGTGAGTATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135701    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145290.2-4283s1c1
Sequence:CCGGCCTTGAAGCTATGAGCATTTACTCGAGTAAATGCTCATAGCTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145290.2-2942s1c1
Sequence:CCGGGCAGCAGCGAACATTAAGAATCTCGAGATTCTTAATGTTCGCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145290.2-3595s1c1
Sequence:CCGGCCAGGGCTGCAAATTAACAAACTCGAGTTTGTTAATTTGCAGCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138161    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145290.2-3101s1c1
Sequence:CCGGCCTGAGCGCAAATATGAGCTTCTCGAGAAGCTCATATTTGCGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145290.2-3494s1c1
Sequence:CCGGCCCAACTCTAATGGGACGAATCTCGAGATTCGTCCCATTAGAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138303    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145290.2-4315s1c1
Sequence:CCGGCAGCCACCATAGGGATTCAAACTCGAGTTTGAATCCCTATGGTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145290
GPR125 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 125
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145290.2-1959s1c1
Sequence:CCGGCCTCTGATCGTACAGGACTTTCTCGAGAAAGTCCTGTACGATCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137426    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145290.2-1733s1c1
Sequence:CCGGGCAAGTAACATCATGTTGGCTCTCGAGAGCCAACATGATGTTACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145290.2-3261s1c1
Sequence:CCGGCCAGCCTTACTTTGCTCTTATCTCGAGATAAGAGCAAAGTAAGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145290.2-3731s1c1
Sequence:CCGGGCGCCTTTAGAAGTTCAGTTTCTCGAGAAACTGAACTTCTAAAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135417    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145290.2-4269s1c1
Sequence:CCGGGTGATACTCACATTCCTTGAACTCGAGTTCAAGGAATGTGAGTATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135701    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145290.2-4283s1c1
Sequence:CCGGCCTTGAAGCTATGAGCATTTACTCGAGTAAATGCTCATAGCTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145290.2-2942s1c1
Sequence:CCGGGCAGCAGCGAACATTAAGAATCTCGAGATTCTTAATGTTCGCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145290.2-3595s1c1
Sequence:CCGGCCAGGGCTGCAAATTAACAAACTCGAGTTTGTTAATTTGCAGCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138161    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145290.2-3101s1c1
Sequence:CCGGCCTGAGCGCAAATATGAGCTTCTCGAGAAGCTCATATTTGCGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145290.2-3494s1c1
Sequence:CCGGCCCAACTCTAATGGGACGAATCTCGAGATTCGTCCCATTAGAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138303    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145290.2-4315s1c1
Sequence:CCGGCAGCCACCATAGGGATTCAAACTCGAGTTTGAATCCCTATGGTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145290
GPR125 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 125
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145290.2-1959s1c1
Sequence:CCGGCCTCTGATCGTACAGGACTTTCTCGAGAAAGTCCTGTACGATCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137426    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145290.2-1733s1c1
Sequence:CCGGGCAAGTAACATCATGTTGGCTCTCGAGAGCCAACATGATGTTACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145290.2-3261s1c1
Sequence:CCGGCCAGCCTTACTTTGCTCTTATCTCGAGATAAGAGCAAAGTAAGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145290.2-3731s1c1
Sequence:CCGGGCGCCTTTAGAAGTTCAGTTTCTCGAGAAACTGAACTTCTAAAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135417    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145290.2-4269s1c1
Sequence:CCGGGTGATACTCACATTCCTTGAACTCGAGTTCAAGGAATGTGAGTATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135701    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145290.2-4283s1c1
Sequence:CCGGCCTTGAAGCTATGAGCATTTACTCGAGTAAATGCTCATAGCTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145290.2-2942s1c1
Sequence:CCGGGCAGCAGCGAACATTAAGAATCTCGAGATTCTTAATGTTCGCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145290.2-3595s1c1
Sequence:CCGGCCAGGGCTGCAAATTAACAAACTCGAGTTTGTTAATTTGCAGCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138161    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145290.2-3101s1c1
Sequence:CCGGCCTGAGCGCAAATATGAGCTTCTCGAGAAGCTCATATTTGCGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145290.2-3494s1c1
Sequence:CCGGCCCAACTCTAATGGGACGAATCTCGAGATTCGTCCCATTAGAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138303    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145290.2-4315s1c1
Sequence:CCGGCAGCCACCATAGGGATTCAAACTCGAGTTTGAATCCCTATGGTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks