EMAIL THIS PAGE TO A FRIEND

GPR126

G protein-coupled receptor 126

137 Gene Product Result for
Synonyms: APG1 DREG PS1TP2 VIGR
Gene ID:
Human(57211) Summary: This gene, which is upregulated in human umbilical vein endothelial cells, encodes a G protein-coupled receptor. Variations in this gene can affect a person's stature. Multiple transcript variants encoding different proteins have been found for this gene. [provided by RefSeq, Mar 2009]
Mouse(215798) G protein-coupled receptor 126
Rat(308376) G protein-coupled receptor 126
sheep(101116915) G protein-coupled receptor 126
Domestic Rabbit(100352263) G protein-coupled receptor 126
domestic guinea pig(100734700) G protein-coupled receptor 126
naked mole-rat(101726739) G protein-coupled receptor 126
Zebrafish(561970) G protein-coupled receptor 126
dog(484013) G protein-coupled receptor 126
cow(534326) G protein-coupled receptor 126
Horse(100060706) G protein-coupled receptor 126
domestic cat(101090869) G protein-coupled receptor 126
chicken(421673) G protein-coupled receptor 126
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020455 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020455 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020455 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001002268 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001002268 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001002268 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001032394 Rosetta Predictions human pricing
NM_001032395 Rosetta Predictions human pricing
NM_020455 Rosetta Predictions human pricing
NM_198569 Rosetta Predictions human pricing
XM_001071417 Rosetta Predictions rat pricing
XM_218313 Rosetta Predictions rat pricing
NM_001002268 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032394 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171011 predicted 3348
2 SASI_Hs01_00171012 predicted 1918
3 SASI_Hs02_00307943 predicted 1540
4 SASI_Hs01_00171013 predicted 2121
5 SASI_Hs01_00171014 predicted 678
6 SASI_Hs02_00307944 predicted 1256
7 SASI_Hs01_00171016 predicted 640
8 SASI_Hs02_00307945 predicted 2526
9 SASI_Hs01_00171017 predicted 1882
10 SASI_Hs02_00307946 predicted 3364
11 SASI_Hs01_00171009 predicted 1211
12 SASI_Hs01_00171010 predicted 3184
13 SASI_Hs01_00171015 predicted 3355
14 SASI_Hs01_00171018 predicted 3298
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032395 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062607 predicted 3343
2 SASI_Hs01_00062608 predicted 1919
3 SASI_Hs02_00307947 predicted 1535
4 SASI_Hs01_00062609 predicted 2121
5 SASI_Hs01_00062610 predicted 682
6 SASI_Hs02_00307948 predicted 1252
7 SASI_Hs01_00062612 predicted 642
8 SASI_Hs02_00307949 predicted 2523
9 SASI_Hs01_00062613 predicted 1882
10 SASI_Hs02_00307950 predicted 3358
11 SASI_Hs01_00062605 predicted 1212
12 SASI_Hs01_00062606 predicted 3177
13 SASI_Hs01_00062611 predicted 3357
14 SASI_Hs01_00062614 predicted 3296
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020455 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240998 predicted 3436
2 SASI_Hs01_00240999 predicted 2001
3 SASI_Hs01_00241000 predicted 2199
4 SASI_Hs01_00241001 predicted 680
5 SASI_Hs02_00353493 predicted 1260
6 SASI_Hs01_00241003 predicted 640
7 SASI_Hs02_00353494 predicted 2612
8 SASI_Hs02_00353495 predicted 1591
9 SASI_Hs01_00241004 predicted 1958
10 SASI_Hs02_00353496 predicted 3450
11 SASI_Hs01_00240996 predicted 1215
12 SASI_Hs01_00240997 predicted 3262
13 SASI_Hs01_00241002 predicted 3438
14 SASI_Hs01_00241005 predicted 3384
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198569 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225647 predicted 3433
2 SASI_Hs01_00225648 predicted 2000
3 SASI_Hs01_00225649 predicted 2205
4 SASI_Hs01_00225650 predicted 677
5 SASI_Hs02_00372199 predicted 1259
6 SASI_Hs01_00225652 predicted 642
7 SASI_Hs02_00372200 predicted 2611
8 SASI_Hs02_00372201 predicted 1590
9 SASI_Hs01_00225653 predicted 1967
10 SASI_Hs02_00372202 predicted 3449
11 SASI_Hs01_00225645 predicted 1215
12 SASI_Hs01_00225646 predicted 3268
13 SASI_Hs01_00225651 predicted 3445
14 SASI_Hs01_00225654 predicted 3379
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071417 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00335080 predicted 584
2 SASI_Rn02_00335081 predicted 1089
3 SASI_Rn02_00335082 predicted 823
4 SASI_Rn02_00335083 predicted 2542
5 SASI_Rn02_00335084 predicted 2236
6 SASI_Rn02_00335085 predicted 1860
7 SASI_Rn02_00335086 predicted 2079
8 SASI_Rn02_00335087 predicted 2500
9 SASI_Rn02_00335088 predicted 3403
10 SASI_Rn02_00335089 predicted 258
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218313 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377672 predicted 583
2 SASI_Rn02_00377673 predicted 1097
3 SASI_Rn02_00377674 predicted 820
4 SASI_Rn02_00377675 predicted 2539
5 SASI_Rn02_00377676 predicted 2239
6 SASI_Rn02_00377677 predicted 1864
7 SASI_Rn02_00377678 predicted 2076
8 SASI_Rn02_00377679 predicted 2498
9 SASI_Rn02_00377680 predicted 254
10 SASI_Rn02_00377681 predicted 1073
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002268 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171934 predicted 362
2 SASI_Mm02_00286288 predicted 1090
3 SASI_Mm01_00171935 predicted 1434
4 SASI_Mm01_00171936 predicted 3375
5 SASI_Mm01_00171937 predicted 2370
6 SASI_Mm01_00171940 predicted 3706
7 SASI_Mm01_00171941 predicted 2632
8 SASI_Mm02_00286289 predicted 3530
9 SASI_Mm02_00286290 predicted 3106
10 SASI_Mm01_00171943 predicted 1256
11 SASI_Mm01_00171938 predicted 934
12 SASI_Mm01_00171939 predicted 2913
13 SASI_Mm01_00171942 predicted 2001
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020455
VALIDATED
GPR126 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 126
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011558    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_020455.3-4068s1c1
Sequence:CCGGGCTCATTCAGACAACTTCTATCTCGAGATAGAAGTTGTCTGAATGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020455.3-2438s1c1
Sequence:CCGGCCAAGCAATAATGAATCGTATCTCGAGATACGATTCATTATTGCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020455.3-2926s1c1
Sequence:CCGGCCTCACTTTCATCAGCTATATCTCGAGATATAGCTGATGAAAGTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020455.3-1776s1c1
Sequence:CCGGCCCTTCTAGTTTACAATGCTACTCGAGTAGCATTGTAAACTAGAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_020455.3-3849s1c1
Sequence:CCGGCCTATCTTACATCCAAATCTACTCGAGTAGATTTGGATGTAAGATAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020455.5-1748s21c1
Sequence:CCGGACACGGTTTATGTCGTTAATACTCGAGTATTAACGACATAAACCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_020455.5-3923s21c1
Sequence:CCGGCCTATCTTACATCCAAATCTACTCGAGTAGATTTGGATGTAAGATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_020455.5-3000s21c1
Sequence:CCGGCCTCACTTTCATCAGCTATATCTCGAGATATAGCTGATGAAAGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273863    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_020455.5-4142s21c1
Sequence:CCGGGCTCATTCAGACAACTTCTATCTCGAGATAGAAGTTGTCTGAATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_020455.5-2210s21c1
Sequence:CCGGACTTAACCTCAGCCAATATTACTCGAGTAATATTGGCTGAGGTTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020455
VALIDATED
GPR126 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 126
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011558    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_020455.3-4068s1c1
Sequence:CCGGGCTCATTCAGACAACTTCTATCTCGAGATAGAAGTTGTCTGAATGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020455.3-2438s1c1
Sequence:CCGGCCAAGCAATAATGAATCGTATCTCGAGATACGATTCATTATTGCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020455.3-2926s1c1
Sequence:CCGGCCTCACTTTCATCAGCTATATCTCGAGATATAGCTGATGAAAGTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020455.3-1776s1c1
Sequence:CCGGCCCTTCTAGTTTACAATGCTACTCGAGTAGCATTGTAAACTAGAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_020455.3-3849s1c1
Sequence:CCGGCCTATCTTACATCCAAATCTACTCGAGTAGATTTGGATGTAAGATAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020455.5-1748s21c1
Sequence:CCGGACACGGTTTATGTCGTTAATACTCGAGTATTAACGACATAAACCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_020455.5-3923s21c1
Sequence:CCGGCCTATCTTACATCCAAATCTACTCGAGTAGATTTGGATGTAAGATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_020455.5-3000s21c1
Sequence:CCGGCCTCACTTTCATCAGCTATATCTCGAGATATAGCTGATGAAAGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273863    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_020455.5-4142s21c1
Sequence:CCGGGCTCATTCAGACAACTTCTATCTCGAGATAGAAGTTGTCTGAATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_020455.5-2210s21c1
Sequence:CCGGACTTAACCTCAGCCAATATTACTCGAGTAATATTGGCTGAGGTTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020455
VALIDATED
GPR126 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 126
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011558    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_020455.3-4068s1c1
Sequence:CCGGGCTCATTCAGACAACTTCTATCTCGAGATAGAAGTTGTCTGAATGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020455.3-2438s1c1
Sequence:CCGGCCAAGCAATAATGAATCGTATCTCGAGATACGATTCATTATTGCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020455.3-2926s1c1
Sequence:CCGGCCTCACTTTCATCAGCTATATCTCGAGATATAGCTGATGAAAGTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020455.3-1776s1c1
Sequence:CCGGCCCTTCTAGTTTACAATGCTACTCGAGTAGCATTGTAAACTAGAAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_020455.3-3849s1c1
Sequence:CCGGCCTATCTTACATCCAAATCTACTCGAGTAGATTTGGATGTAAGATAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020455.5-1748s21c1
Sequence:CCGGACACGGTTTATGTCGTTAATACTCGAGTATTAACGACATAAACCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_020455.5-3923s21c1
Sequence:CCGGCCTATCTTACATCCAAATCTACTCGAGTAGATTTGGATGTAAGATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_020455.5-3000s21c1
Sequence:CCGGCCTCACTTTCATCAGCTATATCTCGAGATATAGCTGATGAAAGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273863    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_020455.5-4142s21c1
Sequence:CCGGGCTCATTCAGACAACTTCTATCTCGAGATAGAAGTTGTCTGAATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_020455.5-2210s21c1
Sequence:CCGGACTTAACCTCAGCCAATATTACTCGAGTAATATTGGCTGAGGTTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002268
GPR126 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 126
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002268.1-1346s1c1
Sequence:CCGGGCTCAATTCAACCTTTCAGAACTCGAGTTCTGAAAGGTTGAATTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193313    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002268.1-6244s1c1
Sequence:CCGGCGTCAGTTTGTTTCATATCTTCTCGAGAAGATATGAAACAAACTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193217    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002268.1-398s1c1
Sequence:CCGGCAACTGTATCTATGACTCATTCTCGAGAATGAGTCATAGATACAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002268.3-4869s21c1
Sequence:CCGGATACAGCTGTCTAGGTTATAACTCGAGTTATAACCTAGACAGCTGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002268.3-291s21c1
Sequence:CCGGACCCTAATGACTACCCTAATACTCGAGTATTAGGGTAGTCATTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002268.3-3591s1c1
Sequence:CCGGGAAACAGCCACTCGGATAATTCTCGAGAATTATCCGAGTGGCTGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002268.3-2621s21c1
Sequence:CCGGCTCACGTTCATTACCTATATTCTCGAGAATATAGGTAATGAACGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002268.3-1260s21c1
Sequence:CCGGACGGAATAATGTATCGAATATCTCGAGATATTCGATACATTATTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002268.3-2924s21c1
Sequence:CCGGACTTACATCCACCGCTATATTCTCGAGAATATAGCGGTGGATGTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002268
GPR126 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 126
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002268.1-1346s1c1
Sequence:CCGGGCTCAATTCAACCTTTCAGAACTCGAGTTCTGAAAGGTTGAATTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193313    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002268.1-6244s1c1
Sequence:CCGGCGTCAGTTTGTTTCATATCTTCTCGAGAAGATATGAAACAAACTGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193217    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002268.1-398s1c1
Sequence:CCGGCAACTGTATCTATGACTCATTCTCGAGAATGAGTCATAGATACAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002268.3-4869s21c1
Sequence:CCGGATACAGCTGTCTAGGTTATAACTCGAGTTATAACCTAGACAGCTGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002268.3-291s21c1
Sequence:CCGGACCCTAATGACTACCCTAATACTCGAGTATTAGGGTAGTCATTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002268.3-3591s1c1
Sequence:CCGGGAAACAGCCACTCGGATAATTCTCGAGAATTATCCGAGTGGCTGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002268.3-2621s21c1
Sequence:CCGGCTCACGTTCATTACCTATATTCTCGAGAATATAGGTAATGAACGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002268.3-1260s21c1
Sequence:CCGGACGGAATAATGTATCGAATATCTCGAGATATTCGATACATTATTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002268.3-2924s21c1
Sequence:CCGGACTTACATCCACCGCTATATTCTCGAGAATATAGCGGTGGATGTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002268
GPR126 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 126
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002268.1-1346s1c1
Sequence:CCGGGCTCAATTCAACCTTTCAGAACTCGAGTTCTGAAAGGTTGAATTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193313    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002268.1-6244s1c1
Sequence:CCGGCGTCAGTTTGTTTCATATCTTCTCGAGAAGATATGAAACAAACTGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193217    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002268.1-398s1c1
Sequence:CCGGCAACTGTATCTATGACTCATTCTCGAGAATGAGTCATAGATACAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002268.3-4869s21c1
Sequence:CCGGATACAGCTGTCTAGGTTATAACTCGAGTTATAACCTAGACAGCTGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002268.3-291s21c1
Sequence:CCGGACCCTAATGACTACCCTAATACTCGAGTATTAGGGTAGTCATTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002268.3-3591s1c1
Sequence:CCGGGAAACAGCCACTCGGATAATTCTCGAGAATTATCCGAGTGGCTGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002268.3-2621s21c1
Sequence:CCGGCTCACGTTCATTACCTATATTCTCGAGAATATAGGTAATGAACGTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002268.3-1260s21c1
Sequence:CCGGACGGAATAATGTATCGAATATCTCGAGATATTCGATACATTATTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002268.3-2924s21c1
Sequence:CCGGACTTACATCCACCGCTATATTCTCGAGAATATAGCGGTGGATGTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)