EMAIL THIS PAGE TO A FRIEND

GPR128

G protein-coupled receptor 128

84 Gene Product Result for
UniProtKB ID: Q96K78, Q14D94, Q86SQ2
Gene ID:
Mouse(239853) G protein-coupled receptor 128
Rat(304014) G protein-coupled receptor 128
Zebrafish(100034596) G protein-coupled receptor 128
domestic cat(101098815) G protein-coupled receptor 128
cow(523482) G protein-coupled receptor 128
Horse(100072256) G protein-coupled receptor 128
dog(487953) G protein-coupled receptor 128
chicken(418390) G protein-coupled receptor 128
domestic guinea pig(100723361) G protein-coupled receptor 128
naked mole-rat(101706915) G protein-coupled receptor 128
sheep(101110721) G protein-coupled receptor 128
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032787 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032787 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032787 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_156286 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_156286 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_156286 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU029221 MISSION® esiRNA esiRNA human GPR128 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032787 Rosetta Predictions human pricing
NM_001107098 Rosetta Predictions rat pricing
NM_172825 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032787 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141618 predicted 2382
2 SASI_Hs01_00141619 predicted 1661
3 SASI_Hs01_00141620 predicted 969
4 SASI_Hs01_00141621 predicted 1986
5 SASI_Hs01_00141622 predicted 2138
6 SASI_Hs01_00141624 predicted 583
7 SASI_Hs01_00141625 predicted 995
8 SASI_Hs01_00141626 predicted 2575
9 SASI_Hs01_00141627 predicted 2273
10 SASI_Hs02_00360344 predicted 2000
11 SASI_Hs01_00141623 predicted 2734
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107098 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225476 predicted 2343
2 SASI_Rn02_00225477 predicted 1958
3 SASI_Rn02_00225478 predicted 2267
4 SASI_Rn02_00225479 predicted 1312
5 SASI_Rn02_00225480 predicted 1502
6 SASI_Rn02_00225481 predicted 684
7 SASI_Rn02_00225482 predicted 432
8 SASI_Rn02_00225483 predicted 2004
9 SASI_Rn02_00225484 predicted 1612
10 SASI_Rn02_00225485 predicted 1700
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172825 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136692 predicted 1007
2 SASI_Mm01_00136693 predicted 1677
3 SASI_Mm01_00136694 predicted 553
4 SASI_Mm01_00136695 predicted 515
5 SASI_Mm01_00136696 predicted 1975
6 SASI_Mm01_00136698 predicted 2449
7 SASI_Mm01_00136699 predicted 323
8 SASI_Mm01_00136700 predicted 2068
9 SASI_Mm02_00344755 predicted 1482
10 SASI_Mm02_00344756 predicted 1910
11 SASI_Mm01_00136697 predicted 1469
12 SASI_Mm01_00136701 predicted 1480
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032787
GPR128 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 128
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032787.2-2327s21c1
Sequence:CCGGGCATACCTGATGCTAGTTAATCTCGAGATTAACTAGCATCAGGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032787.2-953s21c1
Sequence:CCGGGATGCCCTTACAACGCTTATTCTCGAGAATAAGCGTTGTAAGGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032787.2-1501s21c1
Sequence:CCGGCTGCAACCATACTACTAATTTCTCGAGAAATTAGTAGTATGGTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032787.2-1559s21c1
Sequence:CCGGCCCAAATCACTTGACATATTACTCGAGTAATATGTCAAGTGATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032787.1-2758s1c1
Sequence:CCGGGCTCAGGATTAAGAATTAGATCTCGAGATCTAATTCTTAATCCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032787.1-1218s1c1
Sequence:CCGGGCGGCTTTGTAGTTTATCAAACTCGAGTTTGATAAACTACAAAGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032787.1-1901s1c1
Sequence:CCGGGCACAGCTCTATTACCTTCTACTCGAGTAGAAGGTAATAGAGCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032787.1-2555s1c1
Sequence:CCGGCCAACCTTACATGAACGCTTTCTCGAGAAAGCGTTCATGTAAGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032787.1-1101s1c1
Sequence:CCGGGCAGTTCTCTAGTTTCTAGTTCTCGAGAACTAGAAACTAGAGAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032787
GPR128 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 128
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032787.2-2327s21c1
Sequence:CCGGGCATACCTGATGCTAGTTAATCTCGAGATTAACTAGCATCAGGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032787.2-953s21c1
Sequence:CCGGGATGCCCTTACAACGCTTATTCTCGAGAATAAGCGTTGTAAGGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032787.2-1501s21c1
Sequence:CCGGCTGCAACCATACTACTAATTTCTCGAGAAATTAGTAGTATGGTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032787.2-1559s21c1
Sequence:CCGGCCCAAATCACTTGACATATTACTCGAGTAATATGTCAAGTGATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032787.1-2758s1c1
Sequence:CCGGGCTCAGGATTAAGAATTAGATCTCGAGATCTAATTCTTAATCCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032787.1-1218s1c1
Sequence:CCGGGCGGCTTTGTAGTTTATCAAACTCGAGTTTGATAAACTACAAAGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032787.1-1901s1c1
Sequence:CCGGGCACAGCTCTATTACCTTCTACTCGAGTAGAAGGTAATAGAGCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032787.1-2555s1c1
Sequence:CCGGCCAACCTTACATGAACGCTTTCTCGAGAAAGCGTTCATGTAAGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032787.1-1101s1c1
Sequence:CCGGGCAGTTCTCTAGTTTCTAGTTCTCGAGAACTAGAAACTAGAGAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032787
GPR128 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 128
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032787.2-2327s21c1
Sequence:CCGGGCATACCTGATGCTAGTTAATCTCGAGATTAACTAGCATCAGGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032787.2-953s21c1
Sequence:CCGGGATGCCCTTACAACGCTTATTCTCGAGAATAAGCGTTGTAAGGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032787.2-1501s21c1
Sequence:CCGGCTGCAACCATACTACTAATTTCTCGAGAAATTAGTAGTATGGTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032787.2-1559s21c1
Sequence:CCGGCCCAAATCACTTGACATATTACTCGAGTAATATGTCAAGTGATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032787.1-2758s1c1
Sequence:CCGGGCTCAGGATTAAGAATTAGATCTCGAGATCTAATTCTTAATCCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032787.1-1218s1c1
Sequence:CCGGGCGGCTTTGTAGTTTATCAAACTCGAGTTTGATAAACTACAAAGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032787.1-1901s1c1
Sequence:CCGGGCACAGCTCTATTACCTTCTACTCGAGTAGAAGGTAATAGAGCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032787.1-2555s1c1
Sequence:CCGGCCAACCTTACATGAACGCTTTCTCGAGAAAGCGTTCATGTAAGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032787.1-1101s1c1
Sequence:CCGGGCAGTTCTCTAGTTTCTAGTTCTCGAGAACTAGAAACTAGAGAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_156286
GPR128 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 128
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_156286.3-636s1c1
Sequence:CCGGCCTCCTCTTTGTGTTTGGAATCTCGAGATTCCAAACACAAAGAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_156286.3-1409s1c1
Sequence:CCGGCCTTTGATAGAACGAAGCCAACTCGAGTTGGCTTCGTTCTATCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_156286.3-1489s1c1
Sequence:CCGGCCATCCCTAAATGAACGCTTTCTCGAGAAAGCGTTCATTTAGGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_156286.3-873s1c1
Sequence:CCGGCCCTCGGCATTTCATTATCTTCTCGAGAAGATAATGAAATGCCGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_156286.3-1028s1c1
Sequence:CCGGCCAAGGACAATGATTATGCAACTCGAGTTGCATAATCATTGTCCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_156286
GPR128 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 128
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_156286.3-636s1c1
Sequence:CCGGCCTCCTCTTTGTGTTTGGAATCTCGAGATTCCAAACACAAAGAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_156286.3-1409s1c1
Sequence:CCGGCCTTTGATAGAACGAAGCCAACTCGAGTTGGCTTCGTTCTATCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_156286.3-1489s1c1
Sequence:CCGGCCATCCCTAAATGAACGCTTTCTCGAGAAAGCGTTCATTTAGGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_156286.3-873s1c1
Sequence:CCGGCCCTCGGCATTTCATTATCTTCTCGAGAAGATAATGAAATGCCGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_156286.3-1028s1c1
Sequence:CCGGCCAAGGACAATGATTATGCAACTCGAGTTGCATAATCATTGTCCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_156286
GPR128 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 128
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_156286.3-636s1c1
Sequence:CCGGCCTCCTCTTTGTGTTTGGAATCTCGAGATTCCAAACACAAAGAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_156286.3-1409s1c1
Sequence:CCGGCCTTTGATAGAACGAAGCCAACTCGAGTTGGCTTCGTTCTATCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_156286.3-1489s1c1
Sequence:CCGGCCATCCCTAAATGAACGCTTTCTCGAGAAAGCGTTCATTTAGGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_156286.3-873s1c1
Sequence:CCGGCCCTCGGCATTTCATTATCTTCTCGAGAAGATAATGAAATGCCGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_156286.3-1028s1c1
Sequence:CCGGCCAAGGACAATGATTATGCAACTCGAGTTGCATAATCATTGTCCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks