EMAIL THIS PAGE TO A FRIEND

GPR12

G protein-coupled receptor 12

77 Gene Product Result for
Synonyms: GPCR12 GPCR21
UniProtKB ID: P47775, Q5T8P3
Gene ID:
Mouse(14738) G-protein coupled receptor 12
Rat(80840) G protein-coupled receptor 12
sheep(101114624) G protein-coupled receptor 12
naked mole-rat(101718715) G protein-coupled receptor 12
Zebrafish(565609) G protein-coupled receptor 12
dog(486034) G protein-coupled receptor 12
cow(522747) G protein-coupled receptor 12
Horse(100050970) G protein-coupled receptor 12
domestic cat(101086775) G protein-coupled receptor 12
chicken(428079) G protein-coupled receptor 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008151 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008151 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008151 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005288 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005288 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005288 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU044621 MISSION® esiRNA esiRNA human GPR12 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005288 Rosetta Predictions human pricing
NM_001037295 Rosetta Predictions rat pricing
NM_030831 Rosetta Predictions rat pricing
NM_001010941 Rosetta Predictions mouse pricing
NM_008151 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005288 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189748 predicted 451
2 SASI_Hs01_00189749 predicted 624
3 SASI_Hs01_00189750 predicted 325
4 SASI_Hs01_00189752 predicted 649
5 SASI_Hs01_00189753 predicted 378
6 SASI_Hs01_00189754 predicted 448
7 SASI_Hs01_00189755 predicted 773
8 SASI_Hs01_00189756 predicted 389
9 SASI_Hs01_00189757 predicted 637
10 SASI_Hs02_00339338 predicted 462
11 SASI_Hs01_00189751 predicted 282
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037295 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104105 predicted 662
2 SASI_Rn01_00104106 predicted 1098
3 SASI_Rn01_00104107 predicted 592
4 SASI_Rn02_00204360 predicted 821
5 SASI_Rn01_00104108 predicted 551
6 SASI_Rn01_00104109 predicted 1080
7 SASI_Rn02_00204361 predicted 1092
8 SASI_Rn01_00104110 predicted 852
9 SASI_Rn01_00104111 predicted 621
10 SASI_Rn01_00104112 predicted 435
11 SASI_Rn01_00104113 predicted 957
12 SASI_Rn01_00104114 predicted 610
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030831 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112497 predicted 832
2 SASI_Rn01_00112498 predicted 1269
3 SASI_Rn01_00112499 predicted 763
4 SASI_Rn02_00264046 predicted 998
5 SASI_Rn01_00112500 predicted 712
6 SASI_Rn01_00112501 predicted 1250
7 SASI_Rn02_00264047 predicted 1267
8 SASI_Rn01_00112502 predicted 1019
9 SASI_Rn01_00112503 predicted 789
10 SASI_Rn01_00112504 predicted 606
11 SASI_Rn01_00112505 predicted 1123
12 SASI_Rn01_00112506 predicted 780
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010941 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135000 predicted 1075
2 SASI_Mm01_00135001 predicted 959
3 SASI_Mm01_00135002 predicted 888
4 SASI_Mm01_00135003 predicted 1298
5 SASI_Mm01_00135004 predicted 912
6 SASI_Mm01_00135005 predicted 819
7 SASI_Mm01_00135006 predicted 1144
8 SASI_Mm01_00135008 predicted 1151
9 SASI_Mm01_00135009 predicted 1397
10 SASI_Mm02_00286916 predicted 691
11 SASI_Mm01_00135007 predicted 892
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008151 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093343 predicted 854
2 SASI_Mm01_00093344 predicted 748
3 SASI_Mm01_00093345 predicted 679
4 SASI_Mm01_00093346 predicted 1085
5 SASI_Mm01_00093347 predicted 703
6 SASI_Mm01_00093348 predicted 603
7 SASI_Mm01_00093349 predicted 930
8 SASI_Mm01_00093351 predicted 938
9 SASI_Mm01_00093352 predicted 1179
10 SASI_Mm02_00313250 predicted 479
11 SASI_Mm01_00093350 predicted 677
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008151
GPR12 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 12
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008151.x-901s1c1
Sequence:CCGGCTCTATTCCTTGATCGCCGATCTCGAGATCGGCGATCAAGGAATAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008151.x-676s1c1
Sequence:CCGGCTCACTAAGAACAACGCTGCCCTCGAGGGCAGCGTTGTTCTTAGTGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008151.x-804s1c1
Sequence:CCGGCTTCCTGGCTACATCGCACTACTCGAGTAGTGCGATGTAGCCAGGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008151.x-507s1c1
Sequence:CCGGCCGCTACCTCTCGCTATATTACTCGAGTAATATAGCGAGAGGTAGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008151.2-871s1c1
Sequence:CCGGCCTCTCACTAAGAACAACGCTCTCGAGAGCGTTGTTCTTAGTGAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008151.2-645s1c1
Sequence:CCGGCGGACTCATTGTCGCCTCTTTCTCGAGAAAGAGGCGACAATGAGTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008151.2-1101s1c1
Sequence:CCGGCTATTCCTTGATCGCCGATTACTCGAGTAATCGGCGATCAAGGAATAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008151.2-1161s1c1
Sequence:CCGGCGCCACCTACAATTCCATCATCTCGAGATGATGGAATTGTAGGTGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008151
GPR12 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 12
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008151.x-901s1c1
Sequence:CCGGCTCTATTCCTTGATCGCCGATCTCGAGATCGGCGATCAAGGAATAGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008151.x-676s1c1
Sequence:CCGGCTCACTAAGAACAACGCTGCCCTCGAGGGCAGCGTTGTTCTTAGTGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008151.x-804s1c1
Sequence:CCGGCTTCCTGGCTACATCGCACTACTCGAGTAGTGCGATGTAGCCAGGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008151.x-507s1c1
Sequence:CCGGCCGCTACCTCTCGCTATATTACTCGAGTAATATAGCGAGAGGTAGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008151.2-871s1c1
Sequence:CCGGCCTCTCACTAAGAACAACGCTCTCGAGAGCGTTGTTCTTAGTGAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008151.2-645s1c1
Sequence:CCGGCGGACTCATTGTCGCCTCTTTCTCGAGAAAGAGGCGACAATGAGTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008151.2-1101s1c1
Sequence:CCGGCTATTCCTTGATCGCCGATTACTCGAGTAATCGGCGATCAAGGAATAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008151.2-1161s1c1
Sequence:CCGGCGCCACCTACAATTCCATCATCTCGAGATGATGGAATTGTAGGTGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008151
GPR12 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 12
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008151.x-901s1c1
Sequence:CCGGCTCTATTCCTTGATCGCCGATCTCGAGATCGGCGATCAAGGAATAGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008151.x-676s1c1
Sequence:CCGGCTCACTAAGAACAACGCTGCCCTCGAGGGCAGCGTTGTTCTTAGTGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008151.x-804s1c1
Sequence:CCGGCTTCCTGGCTACATCGCACTACTCGAGTAGTGCGATGTAGCCAGGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008151.x-507s1c1
Sequence:CCGGCCGCTACCTCTCGCTATATTACTCGAGTAATATAGCGAGAGGTAGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008151.2-871s1c1
Sequence:CCGGCCTCTCACTAAGAACAACGCTCTCGAGAGCGTTGTTCTTAGTGAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008151.2-645s1c1
Sequence:CCGGCGGACTCATTGTCGCCTCTTTCTCGAGAAAGAGGCGACAATGAGTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008151.2-1101s1c1
Sequence:CCGGCTATTCCTTGATCGCCGATTACTCGAGTAATCGGCGATCAAGGAATAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008151.2-1161s1c1
Sequence:CCGGCGCCACCTACAATTCCATCATCTCGAGATGATGGAATTGTAGGTGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005288
GPR12 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 12
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005288.1-281s1c1
Sequence:CCGGGCATTGGACTCATCACCAATTCTCGAGAATTGGTGATGAGTCCAATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005288.1-40s1c1
Sequence:CCGGCGGGATTATTTAGATGCCGCTCTCGAGAGCGGCATCTAAATAATCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005288.1-807s1c1
Sequence:CCGGCTATTCCTTGATAGCGGATTACTCGAGTAATCCGCTATCAAGGAATAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005288.1-654s1c1
Sequence:CCGGCCAGATCTGTAAGATTGTGATCTCGAGATCACAATCTTACAGATCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005288.1-137s1c1
Sequence:CCGGCCTGGGACATTGTCTTGTGTACTCGAGTACACAAGACAATGTCCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005288.3-651s21c1
Sequence:CCGGCTACGCTCTGACGTACCATTCCTCGAGGAATGGTACGTCAGAGCGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356510    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005288.3-1537s21c1
Sequence:CCGGGATACGCCCATGATGTTATTACTCGAGTAATAACATCATGGGCGTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005288.3-1104s21c1
Sequence:CCGGCATCATCAACCCTGTCATATACTCGAGTATATGACAGGGTTGATGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005288.1-282s21c1
Sequence:GTACCGGCATTGGACTCATCACCAATTTCTCGAGAAATTGGTGATGAGTCCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005288.1-650s21c1
Sequence:GTACCGGACATCCAGATCTGTAAGATTGCTCGAGCAATCTTACAGATCTGGATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005288.1-807s21c1
Sequence:CCGGCTATTCCTTGATAGCGGATTACTCGAGTAATCCGCTATCAAGGAATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005288.1-229s21c1
Sequence:CCGGGCACCCATGTTCCTGCTAATACTCGAGTATTAGCAGGAACATGGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005288.1-31s21c1
Sequence:CCGGGGGCTGCCTCGGGATTATTTACTCGAGTAAATAATCCCGAGGCAGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005288
GPR12 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 12
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005288.1-281s1c1
Sequence:CCGGGCATTGGACTCATCACCAATTCTCGAGAATTGGTGATGAGTCCAATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005288.1-40s1c1
Sequence:CCGGCGGGATTATTTAGATGCCGCTCTCGAGAGCGGCATCTAAATAATCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005288.1-807s1c1
Sequence:CCGGCTATTCCTTGATAGCGGATTACTCGAGTAATCCGCTATCAAGGAATAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005288.1-654s1c1
Sequence:CCGGCCAGATCTGTAAGATTGTGATCTCGAGATCACAATCTTACAGATCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005288.1-137s1c1
Sequence:CCGGCCTGGGACATTGTCTTGTGTACTCGAGTACACAAGACAATGTCCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005288.3-651s21c1
Sequence:CCGGCTACGCTCTGACGTACCATTCCTCGAGGAATGGTACGTCAGAGCGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356510    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005288.3-1537s21c1
Sequence:CCGGGATACGCCCATGATGTTATTACTCGAGTAATAACATCATGGGCGTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005288.3-1104s21c1
Sequence:CCGGCATCATCAACCCTGTCATATACTCGAGTATATGACAGGGTTGATGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005288.1-282s21c1
Sequence:GTACCGGCATTGGACTCATCACCAATTTCTCGAGAAATTGGTGATGAGTCCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005288.1-650s21c1
Sequence:GTACCGGACATCCAGATCTGTAAGATTGCTCGAGCAATCTTACAGATCTGGATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005288.1-807s21c1
Sequence:CCGGCTATTCCTTGATAGCGGATTACTCGAGTAATCCGCTATCAAGGAATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005288.1-229s21c1
Sequence:CCGGGCACCCATGTTCCTGCTAATACTCGAGTATTAGCAGGAACATGGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005288.1-31s21c1
Sequence:CCGGGGGCTGCCTCGGGATTATTTACTCGAGTAAATAATCCCGAGGCAGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005288
GPR12 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 12
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005288.1-281s1c1
Sequence:CCGGGCATTGGACTCATCACCAATTCTCGAGAATTGGTGATGAGTCCAATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005288.1-40s1c1
Sequence:CCGGCGGGATTATTTAGATGCCGCTCTCGAGAGCGGCATCTAAATAATCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005288.1-807s1c1
Sequence:CCGGCTATTCCTTGATAGCGGATTACTCGAGTAATCCGCTATCAAGGAATAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005288.1-654s1c1
Sequence:CCGGCCAGATCTGTAAGATTGTGATCTCGAGATCACAATCTTACAGATCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005288.1-137s1c1
Sequence:CCGGCCTGGGACATTGTCTTGTGTACTCGAGTACACAAGACAATGTCCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005288.3-651s21c1
Sequence:CCGGCTACGCTCTGACGTACCATTCCTCGAGGAATGGTACGTCAGAGCGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356510    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005288.3-1537s21c1
Sequence:CCGGGATACGCCCATGATGTTATTACTCGAGTAATAACATCATGGGCGTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005288.3-1104s21c1
Sequence:CCGGCATCATCAACCCTGTCATATACTCGAGTATATGACAGGGTTGATGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005288.1-282s21c1
Sequence:GTACCGGCATTGGACTCATCACCAATTTCTCGAGAAATTGGTGATGAGTCCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005288.1-650s21c1
Sequence:GTACCGGACATCCAGATCTGTAAGATTGCTCGAGCAATCTTACAGATCTGGATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005288.1-807s21c1
Sequence:CCGGCTATTCCTTGATAGCGGATTACTCGAGTAATCCGCTATCAAGGAATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005288.1-229s21c1
Sequence:CCGGGCACCCATGTTCCTGCTAATACTCGAGTATTAGCAGGAACATGGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005288.1-31s21c1
Sequence:CCGGGGGCTGCCTCGGGATTATTTACTCGAGTAAATAATCCCGAGGCAGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)