EMAIL THIS PAGE TO A FRIEND

GPR132

G protein-coupled receptor 132

63 Gene Product Result for
Synonyms: G2A
UniProtKB ID: Q9UNW8, Q9BSU2
Gene ID:
Human(29933) Summary: This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor (GPCR) superfamily. The receptors are seven-pass transmembrane proteins that respond to extracellular cues and activate intracellular signal transduction pathways. This protein was reported to be a receptor for lysophosphatidylcholine action, but PubMedID: 15653487 retracts this finding and instead suggests this protein to be an effector of lysophosphatidylcholine action. This protein may have proton-sensing activity and may be a receptor for oxidized free fatty acids. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Mouse(56696) G protein-coupled receptor 132
Rat(314480) G protein-coupled receptor 132
sheep(101105692) G protein-coupled receptor 132
naked mole-rat(101697030) G protein-coupled receptor 132
chicken(100859188) G protein-coupled receptor 132
domestic cat(101088939) G protein-coupled receptor 132
dog(612704) G protein-coupled receptor 132
cow(539146) G protein-coupled receptor 132
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013345 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013345 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013345 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019925 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019925 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019925 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU074311 MISSION® esiRNA esiRNA human GPR132 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013345 Rosetta Predictions human pricing
XM_001073056 Rosetta Predictions rat pricing
XM_234574 Rosetta Predictions rat pricing
NM_019925 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013345 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216483 predicted 1419
2 SASI_Hs01_00216484 predicted 1836
3 SASI_Hs01_00216485 predicted 2151
4 SASI_Hs02_00344658 predicted 1230
5 SASI_Hs01_00216486 predicted 2004
6 SASI_Hs01_00216488 predicted 2385
7 SASI_Hs01_00216490 predicted 2395
8 SASI_Hs02_00344659 predicted 2397
9 SASI_Hs01_00216491 predicted 1659
10 SASI_Hs01_00216492 predicted 2407
11 SASI_Hs01_00216487 predicted 1455
12 SASI_Hs01_00216489 predicted 2475
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073056 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00341383 predicted 585
2 SASI_Rn02_00341384 predicted 895
3 SASI_Rn02_00341385 predicted 1037
4 SASI_Rn02_00341386 predicted 831
5 SASI_Rn02_00341387 predicted 361
6 SASI_Rn02_00341388 predicted 1071
7 SASI_Rn02_00341389 predicted 880
8 SASI_Rn02_00341390 predicted 971
9 SASI_Rn02_00341391 predicted 600
10 SASI_Rn02_00341392 predicted 1181
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234574 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388597 predicted 583
2 SASI_Rn02_00388598 predicted 893
3 SASI_Rn02_00388599 predicted 1034
4 SASI_Rn02_00388600 predicted 826
5 SASI_Rn02_00388601 predicted 357
6 SASI_Rn02_00388602 predicted 1076
7 SASI_Rn02_00388603 predicted 886
8 SASI_Rn02_00388604 predicted 978
9 SASI_Rn02_00388605 predicted 608
10 SASI_Rn02_00388606 predicted 1175
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019925 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050103 predicted 1285
2 SASI_Mm01_00050105 predicted 1100
3 SASI_Mm01_00050106 predicted 1093
4 SASI_Mm01_00050107 predicted 454
5 SASI_Mm02_00325204 predicted 581
6 SASI_Mm01_00050108 predicted 513
7 SASI_Mm01_00050110 predicted 386
8 SASI_Mm01_00050111 predicted 503
9 SASI_Mm01_00050112 predicted 627
10 SASI_Mm02_00325205 predicted 978
11 SASI_Mm01_00050104 predicted 921
12 SASI_Mm01_00050109 predicted 1235
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013345
GPR132 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 132
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013345.2-1190s1c1
Sequence:CCGGCTGGGTCATCTATATCCGCAACTCGAGTTGCGGATATAGATGACCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013345.2-1008s1c1
Sequence:CCGGTCCTTCGAAGAGAGCAGGATACTCGAGTATCCTGCTCTCTTCGAAGGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013345.2-1268s1c1
Sequence:CCGGCTGCAACATCTACGTCAGCATCTCGAGATGCTGACGTAGATGTTGCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013345.2-1844s1c1
Sequence:CCGGCCGCCAAGAAGTGTCCAGAATCTCGAGATTCTGGACACTTCTTGGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011429    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013345.2-3191s1c1
Sequence:CCGGGCTATGCAGTTGCTCTTCCTTCTCGAGAAGGAAGAGCAACTGCATAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013345.2-1851s21c1
Sequence:CCGGGAAGTGTCCAGAATCCATAAGCTCGAGCTTATGGATTCTGGACACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357049    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013345.2-2142s21c1
Sequence:CCGGTGGAAGACAAACTACCAATTTCTCGAGAAATTGGTAGTTTGTCTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013345.2-1183s21c1
Sequence:CCGGTGCCACTCTGGGTCATCTATACTCGAGTATAGATGACCCAGAGTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013345.2-1546s21c1
Sequence:CCGGCCTTCACCAACCACCGGATTTCTCGAGAAATCCGGTGGTTGGTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013345
GPR132 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 132
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013345.2-1190s1c1
Sequence:CCGGCTGGGTCATCTATATCCGCAACTCGAGTTGCGGATATAGATGACCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013345.2-1008s1c1
Sequence:CCGGTCCTTCGAAGAGAGCAGGATACTCGAGTATCCTGCTCTCTTCGAAGGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013345.2-1268s1c1
Sequence:CCGGCTGCAACATCTACGTCAGCATCTCGAGATGCTGACGTAGATGTTGCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013345.2-1844s1c1
Sequence:CCGGCCGCCAAGAAGTGTCCAGAATCTCGAGATTCTGGACACTTCTTGGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011429    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013345.2-3191s1c1
Sequence:CCGGGCTATGCAGTTGCTCTTCCTTCTCGAGAAGGAAGAGCAACTGCATAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013345.2-1851s21c1
Sequence:CCGGGAAGTGTCCAGAATCCATAAGCTCGAGCTTATGGATTCTGGACACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357049    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013345.2-2142s21c1
Sequence:CCGGTGGAAGACAAACTACCAATTTCTCGAGAAATTGGTAGTTTGTCTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013345.2-1183s21c1
Sequence:CCGGTGCCACTCTGGGTCATCTATACTCGAGTATAGATGACCCAGAGTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013345.2-1546s21c1
Sequence:CCGGCCTTCACCAACCACCGGATTTCTCGAGAAATCCGGTGGTTGGTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013345
GPR132 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 132
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013345.2-1190s1c1
Sequence:CCGGCTGGGTCATCTATATCCGCAACTCGAGTTGCGGATATAGATGACCCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013345.2-1008s1c1
Sequence:CCGGTCCTTCGAAGAGAGCAGGATACTCGAGTATCCTGCTCTCTTCGAAGGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013345.2-1268s1c1
Sequence:CCGGCTGCAACATCTACGTCAGCATCTCGAGATGCTGACGTAGATGTTGCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013345.2-1844s1c1
Sequence:CCGGCCGCCAAGAAGTGTCCAGAATCTCGAGATTCTGGACACTTCTTGGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011429    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013345.2-3191s1c1
Sequence:CCGGGCTATGCAGTTGCTCTTCCTTCTCGAGAAGGAAGAGCAACTGCATAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013345.2-1851s21c1
Sequence:CCGGGAAGTGTCCAGAATCCATAAGCTCGAGCTTATGGATTCTGGACACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357049    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013345.2-2142s21c1
Sequence:CCGGTGGAAGACAAACTACCAATTTCTCGAGAAATTGGTAGTTTGTCTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013345.2-1183s21c1
Sequence:CCGGTGCCACTCTGGGTCATCTATACTCGAGTATAGATGACCCAGAGTGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013345.2-1546s21c1
Sequence:CCGGCCTTCACCAACCACCGGATTTCTCGAGAAATCCGGTGGTTGGTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019925
GPR132 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 132
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019925.2-1121s1c1
Sequence:CCGGCCACAGAGCTTTCAAACACATCTCGAGATGTGTTTGAAAGCTCTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019925.2-1070s1c1
Sequence:CCGGCCACAAAGACATATGTTACATCTCGAGATGTAACATATGTCTTTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019925.2-453s1c1
Sequence:CCGGCATCTACATCAGCATCCTCTTCTCGAGAAGAGGATGCTGATGTAGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019925.2-363s1c1
Sequence:CCGGGCCATTGTGGATCATCTACATCTCGAGATGTAGATGATCCACAATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019925.2-568s1c1
Sequence:CCGGGCGTGTGTGATTCTTCTTGTTCTCGAGAACAAGAAGAATCACACACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019925
GPR132 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 132
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019925.2-1121s1c1
Sequence:CCGGCCACAGAGCTTTCAAACACATCTCGAGATGTGTTTGAAAGCTCTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019925.2-1070s1c1
Sequence:CCGGCCACAAAGACATATGTTACATCTCGAGATGTAACATATGTCTTTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019925.2-453s1c1
Sequence:CCGGCATCTACATCAGCATCCTCTTCTCGAGAAGAGGATGCTGATGTAGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019925.2-363s1c1
Sequence:CCGGGCCATTGTGGATCATCTACATCTCGAGATGTAGATGATCCACAATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019925.2-568s1c1
Sequence:CCGGGCGTGTGTGATTCTTCTTGTTCTCGAGAACAAGAAGAATCACACACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019925
GPR132 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 132
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019925.2-1121s1c1
Sequence:CCGGCCACAGAGCTTTCAAACACATCTCGAGATGTGTTTGAAAGCTCTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019925.2-1070s1c1
Sequence:CCGGCCACAAAGACATATGTTACATCTCGAGATGTAACATATGTCTTTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019925.2-453s1c1
Sequence:CCGGCATCTACATCAGCATCCTCTTCTCGAGAAGAGGATGCTGATGTAGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019925.2-363s1c1
Sequence:CCGGGCCATTGTGGATCATCTACATCTCGAGATGTAGATGATCCACAATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019925.2-568s1c1
Sequence:CCGGGCGTGTGTGATTCTTCTTGTTCTCGAGAACAAGAAGAATCACACACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)