EMAIL THIS PAGE TO A FRIEND

GPR133

G protein-coupled receptor 133

66 Gene Product Result for
Synonyms: PGR25
UniProtKB ID: Q6QNK2, Q2M1L3, Q6ZMQ1, Q7Z7M2, Q86SM4
Gene ID:
Human(283383) Summary: The adhesion G-protein-coupled receptors (GPCRs), including GPR133, are membrane-bound proteins with long N termini containing multiple domains. GPCRs, or GPRs, contain 7 transmembrane domains and transduce extracellular signals through heterotrimeric G proteins (summary by Bjarnadottir et al., 2004 [PubMed 15203201]
Mouse(243277) G protein-coupled receptor 133
Rat(689257) G protein-coupled receptor 133
Zebrafish(791731) G protein-coupled receptor 133
cow(528174) G protein-coupled receptor 133
Horse(100062695) G protein-coupled receptor 133
domestic cat(101080410) G protein-coupled receptor 133
dog(486229) G protein-coupled receptor 133
chicken(416803) G protein-coupled receptor 133
domestic guinea pig(100718623) G protein-coupled receptor 133
naked mole-rat(101712339) G protein-coupled receptor 133
sheep(101113363) G protein-coupled receptor 133
Domestic Rabbit(100352052) G protein-coupled receptor 133
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198827 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198827 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198827 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177734 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177734 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177734 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU101681 MISSION® esiRNA esiRNA human GPR133 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198827 Rosetta Predictions human pricing
XM_001070157 Rosetta Predictions rat pricing
NM_001081342 Rosetta Predictions mouse pricing
XM_485685 Rosetta Predictions mouse pricing
XM_895977 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198827 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188221 predicted 319
2 SASI_Hs01_00188222 predicted 674
3 SASI_Hs01_00188223 predicted 894
4 SASI_Hs02_00372331 predicted 2235
5 SASI_Hs01_00188225 predicted 266
6 SASI_Hs01_00188226 predicted 349
7 SASI_Hs01_00188227 predicted 836
8 SASI_Hs01_00188228 predicted 1033
9 SASI_Hs01_00188229 predicted 1090
10 SASI_Hs01_00188230 predicted 1614
11 SASI_Hs01_00188224 predicted 2339
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070157 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00330632 predicted 821
2 SASI_Rn02_00330633 predicted 1467
3 SASI_Rn02_00330634 predicted 713
4 SASI_Rn02_00330635 predicted 506
5 SASI_Rn02_00330636 predicted 668
6 SASI_Rn02_00330637 predicted 582
7 SASI_Rn02_00330638 predicted 911
8 SASI_Rn02_00330639 predicted 1251
9 SASI_Rn02_00330640 predicted 1280
10 SASI_Rn02_00330641 predicted 800
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081342 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297471 predicted 1219
2 SASI_Mm02_00297472 predicted 535
3 SASI_Mm02_00297473 predicted 2451
4 SASI_Mm02_00297474 predicted 2470
5 SASI_Mm02_00297475 predicted 2852
6 SASI_Mm02_00297476 predicted 1572
7 SASI_Mm02_00297477 predicted 2130
8 SASI_Mm02_00297478 predicted 1937
9 SASI_Mm02_00297479 predicted 1327
10 SASI_Mm02_00297480 predicted 534
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_485685 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00244952 predicted 1129
2 SASI_Mm01_00244953 predicted 540
3 SASI_Mm01_00244954 predicted 2362
4 SASI_Mm01_00244955 predicted 2381
5 SASI_Mm01_00244956 predicted 1321
6 SASI_Mm01_00244957 predicted 2760
7 SASI_Mm01_00244958 predicted 1482
8 SASI_Mm01_00244959 predicted 1848
9 SASI_Mm01_00244960 predicted 1231
10 SASI_Mm01_00244961 predicted 1668
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895977 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00256603 predicted 1220
2 SASI_Mm01_00256604 predicted 540
3 SASI_Mm01_00256605 predicted 2463
4 SASI_Mm01_00256606 predicted 2476
5 SASI_Mm01_00256607 predicted 1422
6 SASI_Mm01_00256608 predicted 2864
7 SASI_Mm01_00256609 predicted 1571
8 SASI_Mm01_00256610 predicted 2136
9 SASI_Mm01_00256611 predicted 1944
10 SASI_Mm01_00256612 predicted 1327
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198827
GPR133 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 133
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198827.3-2181s21c1
Sequence:CCGGGCACTCACCTCACCAACTTTGCTCGAGCAAAGTTGGTGAGGTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198827.3-1056s21c1
Sequence:CCGGATTGGACTCATGTCCTATTTACTCGAGTAAATAGGACATGAGTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198827.3-2649s21c1
Sequence:CCGGGTTACGGAACAAGCAACAATTCTCGAGAATTGTTGCTTGTTCCGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198827.3-1381s21c1
Sequence:CCGGTGCCTACCATCCCATCATAACCTCGAGGTTATGATGGGATGGTAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198827.3-1170s21c1
Sequence:CCGGCCAACGTCAACCTCGTGATAGCTCGAGCTATCACGAGGTTGACGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198827.3-2568s21c1
Sequence:CCGGGCAAGCACCGTTACTACTATGCTCGAGCATAGTAGTAACGGTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198827.3-1989s21c1
Sequence:CCGGTGTCGGGCTCTCCACTCATTACTCGAGTAATGAGTGGAGAGCCCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198827.3-1602s21c1
Sequence:CCGGTGAGTCTCATCGACACTATTGCTCGAGCAATAGTGTCGATGAGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198827.2-683s1c1
Sequence:CCGGCCTATTTACATGGAAATCCAACTCGAGTTGGATTTCCATGTAAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198827.2-2333s1c1
Sequence:CCGGCCTGTTTGTCATCGTGGTCAACTCGAGTTGACCACGATGACAAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198827.2-818s1c1
Sequence:CCGGCCAGGCCAAGTGTTATGAGAACTCGAGTTCTCATAACACTTGGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198827.2-1226s1c1
Sequence:CCGGCGACACTATTGACACCGTCATCTCGAGATGACGGTGTCAATAGTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198827.2-2186s1c1
Sequence:CCGGGCACCGTTACTACTATGGGATCTCGAGATCCCATAGTAGTAACGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198827
GPR133 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 133
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198827.3-2181s21c1
Sequence:CCGGGCACTCACCTCACCAACTTTGCTCGAGCAAAGTTGGTGAGGTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198827.3-1056s21c1
Sequence:CCGGATTGGACTCATGTCCTATTTACTCGAGTAAATAGGACATGAGTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198827.3-2649s21c1
Sequence:CCGGGTTACGGAACAAGCAACAATTCTCGAGAATTGTTGCTTGTTCCGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198827.3-1381s21c1
Sequence:CCGGTGCCTACCATCCCATCATAACCTCGAGGTTATGATGGGATGGTAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198827.3-1170s21c1
Sequence:CCGGCCAACGTCAACCTCGTGATAGCTCGAGCTATCACGAGGTTGACGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198827.3-2568s21c1
Sequence:CCGGGCAAGCACCGTTACTACTATGCTCGAGCATAGTAGTAACGGTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198827.3-1989s21c1
Sequence:CCGGTGTCGGGCTCTCCACTCATTACTCGAGTAATGAGTGGAGAGCCCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198827.3-1602s21c1
Sequence:CCGGTGAGTCTCATCGACACTATTGCTCGAGCAATAGTGTCGATGAGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198827.2-683s1c1
Sequence:CCGGCCTATTTACATGGAAATCCAACTCGAGTTGGATTTCCATGTAAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198827.2-2333s1c1
Sequence:CCGGCCTGTTTGTCATCGTGGTCAACTCGAGTTGACCACGATGACAAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198827.2-818s1c1
Sequence:CCGGCCAGGCCAAGTGTTATGAGAACTCGAGTTCTCATAACACTTGGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198827.2-1226s1c1
Sequence:CCGGCGACACTATTGACACCGTCATCTCGAGATGACGGTGTCAATAGTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198827.2-2186s1c1
Sequence:CCGGGCACCGTTACTACTATGGGATCTCGAGATCCCATAGTAGTAACGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198827
GPR133 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 133
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198827.3-2181s21c1
Sequence:CCGGGCACTCACCTCACCAACTTTGCTCGAGCAAAGTTGGTGAGGTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198827.3-1056s21c1
Sequence:CCGGATTGGACTCATGTCCTATTTACTCGAGTAAATAGGACATGAGTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198827.3-2649s21c1
Sequence:CCGGGTTACGGAACAAGCAACAATTCTCGAGAATTGTTGCTTGTTCCGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198827.3-1381s21c1
Sequence:CCGGTGCCTACCATCCCATCATAACCTCGAGGTTATGATGGGATGGTAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198827.3-1170s21c1
Sequence:CCGGCCAACGTCAACCTCGTGATAGCTCGAGCTATCACGAGGTTGACGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198827.3-2568s21c1
Sequence:CCGGGCAAGCACCGTTACTACTATGCTCGAGCATAGTAGTAACGGTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198827.3-1989s21c1
Sequence:CCGGTGTCGGGCTCTCCACTCATTACTCGAGTAATGAGTGGAGAGCCCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198827.3-1602s21c1
Sequence:CCGGTGAGTCTCATCGACACTATTGCTCGAGCAATAGTGTCGATGAGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198827.2-683s1c1
Sequence:CCGGCCTATTTACATGGAAATCCAACTCGAGTTGGATTTCCATGTAAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198827.2-2333s1c1
Sequence:CCGGCCTGTTTGTCATCGTGGTCAACTCGAGTTGACCACGATGACAAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198827.2-818s1c1
Sequence:CCGGCCAGGCCAAGTGTTATGAGAACTCGAGTTCTCATAACACTTGGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198827.2-1226s1c1
Sequence:CCGGCGACACTATTGACACCGTCATCTCGAGATGACGGTGTCAATAGTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198827.2-2186s1c1
Sequence:CCGGGCACCGTTACTACTATGGGATCTCGAGATCCCATAGTAGTAACGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177734
GPR133 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 133
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177734.2-852s1c1
Sequence:CCGGCGAAGCCTTTCAGTTCAGACACTCGAGTGTCTGAACTGAAAGGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177734.2-256s1c1
Sequence:CCGGCCTCCTACATTACTTCTTCCTCTCGAGAGGAAGAAGTAATGTAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177734.2-894s1c1
Sequence:CCGGGCACGGCATCTACAAAGCTAACTCGAGTTAGCTTTGTAGATGCCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177734.2-715s1c1
Sequence:CCGGGTTTGCTATACTCAACTCTTTCTCGAGAAAGAGTTGAGTATAGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177734.2-765s1c1
Sequence:CCGGGTCTCCTGAACTCAGAGGTAACTCGAGTTACCTCTGAGTTCAGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177734
GPR133 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 133
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177734.2-852s1c1
Sequence:CCGGCGAAGCCTTTCAGTTCAGACACTCGAGTGTCTGAACTGAAAGGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177734.2-256s1c1
Sequence:CCGGCCTCCTACATTACTTCTTCCTCTCGAGAGGAAGAAGTAATGTAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177734.2-894s1c1
Sequence:CCGGGCACGGCATCTACAAAGCTAACTCGAGTTAGCTTTGTAGATGCCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177734.2-715s1c1
Sequence:CCGGGTTTGCTATACTCAACTCTTTCTCGAGAAAGAGTTGAGTATAGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177734.2-765s1c1
Sequence:CCGGGTCTCCTGAACTCAGAGGTAACTCGAGTTACCTCTGAGTTCAGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177734
GPR133 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 133
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177734.2-852s1c1
Sequence:CCGGCGAAGCCTTTCAGTTCAGACACTCGAGTGTCTGAACTGAAAGGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177734.2-256s1c1
Sequence:CCGGCCTCCTACATTACTTCTTCCTCTCGAGAGGAAGAAGTAATGTAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177734.2-894s1c1
Sequence:CCGGGCACGGCATCTACAAAGCTAACTCGAGTTAGCTTTGTAGATGCCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177734.2-715s1c1
Sequence:CCGGGTTTGCTATACTCAACTCTTTCTCGAGAAAGAGTTGAGTATAGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177734.2-765s1c1
Sequence:CCGGGTCTCCTGAACTCAGAGGTAACTCGAGTTACCTCTGAGTTCAGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks