EMAIL THIS PAGE TO A FRIEND

GPR135

G protein-coupled receptor 135

Synonyms: HUMNPIIY20
UniProtKB ID: Q8IZ08, Q7Z604, Q86SM3, Q8NH39
Gene ID:
Mouse(238252) G protein-coupled receptor 135
Rat(314213) G protein-coupled receptor 135
sheep(101116837) G protein-coupled receptor 135
naked mole-rat(101706418) G protein-coupled receptor 135
chicken(428921) G protein-coupled receptor 135
dog(100687691) G protein-coupled receptor 135
domestic cat(101099975) G protein-coupled receptor 135
cow(781195) G protein-coupled receptor 135
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181752 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181752 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181752 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022571 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022571 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022571 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022571 Rosetta Predictions human pricing
NM_181771 Rosetta Predictions rat pricing
NM_181752 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022571 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185663 predicted 1329
2 SASI_Hs01_00185664 predicted 1252
3 SASI_Hs01_00185665 predicted 965
4 SASI_Hs01_00185666 predicted 1395
5 SASI_Hs01_00185667 predicted 1280
6 SASI_Hs01_00185668 predicted 1431
7 SASI_Hs01_00185669 predicted 982
8 SASI_Hs01_00185670 predicted 1108
9 SASI_Hs01_00185671 predicted 1147
10 SASI_Hs02_00355863 predicted 1543
11 SASI_Hs01_00185662 predicted 1005
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181771 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093333 predicted 747
2 SASI_Rn01_00093334 predicted 1098
3 SASI_Rn01_00093335 predicted 1104
4 SASI_Rn01_00093336 predicted 928
5 SASI_Rn01_00093337 predicted 1027
6 SASI_Rn01_00093338 predicted 482
7 SASI_Rn01_00093339 predicted 1038
8 SASI_Rn01_00093340 predicted 942
9 SASI_Rn01_00093341 predicted 876
10 SASI_Rn01_00093342 predicted 734
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181752 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086986 predicted 1107
2 SASI_Mm01_00086987 predicted 723
3 SASI_Mm02_00349920 predicted 886
4 SASI_Mm01_00086988 predicted 477
5 SASI_Mm01_00086989 predicted 1027
6 SASI_Mm01_00086991 predicted 1041
7 SASI_Mm01_00086992 predicted 468
8 SASI_Mm01_00086993 predicted 1094
9 SASI_Mm01_00086994 predicted 736
10 SASI_Mm02_00349921 predicted 451
11 SASI_Mm01_00086990 predicted 882
12 SASI_Mm01_00086995 predicted 1108
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181752
GPR135 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 135
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181752.1-38s1c1
Sequence:CCGGCGAGTGCAACCTTGCAGGGTACTCGAGTACCCTGCAAGGTTGCACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181752.1-753s1c1
Sequence:CCGGGCCCTTCCTACTGATGTGTTTCTCGAGAAACACATCAGTAGGAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181752.1-450s1c1
Sequence:CCGGCCGCTTCTTCAGTTCGTGTTTCTCGAGAAACACGAACTGAAGAAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181752.1-886s1c1
Sequence:CCGGGTGCTCATCATGATTATCTTTCTCGAGAAAGATAATCATGATGAGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181752.1-1110s1c1
Sequence:CCGGGACTAGAAACATGGATGCTTTCTCGAGAAAGCATCCATGTTTCTAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181752
GPR135 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 135
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181752.1-38s1c1
Sequence:CCGGCGAGTGCAACCTTGCAGGGTACTCGAGTACCCTGCAAGGTTGCACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181752.1-753s1c1
Sequence:CCGGGCCCTTCCTACTGATGTGTTTCTCGAGAAACACATCAGTAGGAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181752.1-450s1c1
Sequence:CCGGCCGCTTCTTCAGTTCGTGTTTCTCGAGAAACACGAACTGAAGAAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181752.1-886s1c1
Sequence:CCGGGTGCTCATCATGATTATCTTTCTCGAGAAAGATAATCATGATGAGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181752.1-1110s1c1
Sequence:CCGGGACTAGAAACATGGATGCTTTCTCGAGAAAGCATCCATGTTTCTAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181752
GPR135 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 135
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181752.1-38s1c1
Sequence:CCGGCGAGTGCAACCTTGCAGGGTACTCGAGTACCCTGCAAGGTTGCACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181752.1-753s1c1
Sequence:CCGGGCCCTTCCTACTGATGTGTTTCTCGAGAAACACATCAGTAGGAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181752.1-450s1c1
Sequence:CCGGCCGCTTCTTCAGTTCGTGTTTCTCGAGAAACACGAACTGAAGAAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181752.1-886s1c1
Sequence:CCGGGTGCTCATCATGATTATCTTTCTCGAGAAAGATAATCATGATGAGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181752.1-1110s1c1
Sequence:CCGGGACTAGAAACATGGATGCTTTCTCGAGAAAGCATCCATGTTTCTAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022571
GPR135 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 135
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022571.3-1174s1c1
Sequence:CCGGCCCAACATTTCGATGCTCCTACTCGAGTAGGAGCATCGAAATGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022571.3-1221s1c1
Sequence:CCGGGACTAGGAATGTGGACGCTTTCTCGAGAAAGCGTCCACATTCCTAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022571.3-609s1c1
Sequence:CCGGGCTCATCTCGTTGGACCGTTACTCGAGTAACGGTCCAACGAGATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022571.3-354s1c1
Sequence:CCGGCCTTGGCAACTGCGCGGTGATCTCGAGATCACCGCGCAGTTGCCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022571.5-1555s21c1
Sequence:CCGGAGTGACCAAACAGCCTAAATCCTCGAGGATTTAGGCTGTTTGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022571.5-1278s21c1
Sequence:CCGGCCATCCGCAATCCCAACATTTCTCGAGAAATGTTGGGATTGCGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022571.5-734s21c1
Sequence:CCGGTTGGACCGTTACTGCGCTATCCTCGAGGATAGCGCAGTAACGGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357507    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022571.5-1629s21c1
Sequence:CCGGCAAATTTCCACTCGCATTATTCTCGAGAATAATGCGAGTGGAAATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022571.5-1604s21c1
Sequence:CCGGGGTTGGAATGGCCAGCTTATGCTCGAGCATAAGCTGGCCATTCCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022571
GPR135 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 135
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022571.3-1174s1c1
Sequence:CCGGCCCAACATTTCGATGCTCCTACTCGAGTAGGAGCATCGAAATGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022571.3-1221s1c1
Sequence:CCGGGACTAGGAATGTGGACGCTTTCTCGAGAAAGCGTCCACATTCCTAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022571.3-609s1c1
Sequence:CCGGGCTCATCTCGTTGGACCGTTACTCGAGTAACGGTCCAACGAGATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022571.3-354s1c1
Sequence:CCGGCCTTGGCAACTGCGCGGTGATCTCGAGATCACCGCGCAGTTGCCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022571.5-1555s21c1
Sequence:CCGGAGTGACCAAACAGCCTAAATCCTCGAGGATTTAGGCTGTTTGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022571.5-1278s21c1
Sequence:CCGGCCATCCGCAATCCCAACATTTCTCGAGAAATGTTGGGATTGCGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022571.5-734s21c1
Sequence:CCGGTTGGACCGTTACTGCGCTATCCTCGAGGATAGCGCAGTAACGGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357507    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022571.5-1629s21c1
Sequence:CCGGCAAATTTCCACTCGCATTATTCTCGAGAATAATGCGAGTGGAAATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022571.5-1604s21c1
Sequence:CCGGGGTTGGAATGGCCAGCTTATGCTCGAGCATAAGCTGGCCATTCCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022571
GPR135 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 135
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022571.3-1174s1c1
Sequence:CCGGCCCAACATTTCGATGCTCCTACTCGAGTAGGAGCATCGAAATGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022571.3-1221s1c1
Sequence:CCGGGACTAGGAATGTGGACGCTTTCTCGAGAAAGCGTCCACATTCCTAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022571.3-609s1c1
Sequence:CCGGGCTCATCTCGTTGGACCGTTACTCGAGTAACGGTCCAACGAGATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022571.3-354s1c1
Sequence:CCGGCCTTGGCAACTGCGCGGTGATCTCGAGATCACCGCGCAGTTGCCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022571.5-1555s21c1
Sequence:CCGGAGTGACCAAACAGCCTAAATCCTCGAGGATTTAGGCTGTTTGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022571.5-1278s21c1
Sequence:CCGGCCATCCGCAATCCCAACATTTCTCGAGAAATGTTGGGATTGCGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022571.5-734s21c1
Sequence:CCGGTTGGACCGTTACTGCGCTATCCTCGAGGATAGCGCAGTAACGGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357507    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022571.5-1629s21c1
Sequence:CCGGCAAATTTCCACTCGCATTATTCTCGAGAATAATGCGAGTGGAAATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022571.5-1604s21c1
Sequence:CCGGGGTTGGAATGGCCAGCTTATGCTCGAGCATAAGCTGGCCATTCCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks