EMAIL THIS PAGE TO A FRIEND

GPR137

G protein-coupled receptor 137

81 Gene Product Result for
Synonyms: C11orf4 GPR137A TM7SF1L1
UniProtKB ID: Q96N19, B4DTG7, B7Z7M1, Q4G0Y9, Q8N4K6
Gene ID:
Mouse(107173) G protein-coupled receptor 137
Rat(689984) G protein-coupled receptor 137
cow(505015) G protein-coupled receptor 137
domestic cat(101098989) G protein-coupled receptor 137
dog(612124) G protein-coupled receptor 137
domestic guinea pig(100729535) G protein-coupled receptor 137
naked mole-rat(101726414) G protein-coupled receptor 137
sheep(101103102) G protein-coupled receptor 137
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020155 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020155 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020155 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_207220 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207220 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207220 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020155 Rosetta Predictions human pricing
NM_001109562 Rosetta Predictions rat pricing
NM_207220 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020155 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230971 predicted 1049
2 SASI_Hs02_00353050 predicted 623
3 SASI_Hs01_00230972 predicted 1059
4 SASI_Hs01_00230973 predicted 411
5 SASI_Hs01_00230974 predicted 639
6 SASI_Hs01_00230975 predicted 460
7 SASI_Hs01_00230976 predicted 1000
8 SASI_Hs01_00230977 predicted 635
9 SASI_Hs01_00230978 predicted 531
10 SASI_Hs02_00353051 predicted 1140
11 SASI_Hs01_00230969 predicted 630
12 SASI_Hs01_00230970 predicted 525
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109562 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249611 predicted 906
2 SASI_Rn02_00249612 predicted 252
3 SASI_Rn02_00249613 predicted 897
4 SASI_Rn02_00249614 predicted 401
5 SASI_Rn02_00249615 predicted 795
6 SASI_Rn02_00249616 predicted 1016
7 SASI_Rn02_00249617 predicted 992
8 SASI_Rn02_00249618 predicted 1004
9 SASI_Rn02_00249619 predicted 510
10 SASI_Rn02_00249620 predicted 488
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207220 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093768 predicted 966
2 SASI_Mm01_00093769 predicted 552
3 SASI_Mm01_00093770 predicted 1380
4 SASI_Mm01_00093771 predicted 962
5 SASI_Mm01_00093772 predicted 547
6 SASI_Mm02_00351941 predicted 866
7 SASI_Mm01_00093773 predicted 1011
8 SASI_Mm01_00093774 predicted 467
9 SASI_Mm01_00093776 predicted 761
10 SASI_Mm01_00093777 predicted 1032
11 SASI_Mm01_00093775 predicted 320
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020155
GPR137 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 137
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000359738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020155.2-539s21c1
Sequence:CCGGCTCCTTCTACTTCCGAGATACCTCGAGGTATCTCGGAAGTAGAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020155.2-627s21c1
Sequence:CCGGTTCTTCACCTTGACGCTTATGCTCGAGCATAAGCGTCAAGGTGAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020155.2-1060s1c1
Sequence:CCGGTCGATTACGGCTGGTACAATGCTCGAGCATTGTACCAGCCGTAATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020155.2-415s1c1
Sequence:CCGGTGCTCTTCTTCTCCGTCTATGCTCGAGCATAGACGGAGAAGAAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020155.2-1117s21c1
Sequence:CCGGACAAAGGCTACCTGGTATTTGCTCGAGCAAATACCAGGTAGCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020155.2-626s1c1
Sequence:CCGGGTTCTTCACCTTGACGCTTATCTCGAGATAAGCGTCAAGGTGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020155.2-638s1c1
Sequence:CCGGGACGCTTATGAACCTCTACTTCTCGAGAAGTAGAGGTTCATAAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020155.2-1115s1c1
Sequence:CCGGGAACAAAGGCTACCTGGTATTCTCGAGAATACCAGGTAGCCTTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020155
GPR137 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 137
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000359738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020155.2-539s21c1
Sequence:CCGGCTCCTTCTACTTCCGAGATACCTCGAGGTATCTCGGAAGTAGAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020155.2-627s21c1
Sequence:CCGGTTCTTCACCTTGACGCTTATGCTCGAGCATAAGCGTCAAGGTGAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020155.2-1060s1c1
Sequence:CCGGTCGATTACGGCTGGTACAATGCTCGAGCATTGTACCAGCCGTAATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020155.2-415s1c1
Sequence:CCGGTGCTCTTCTTCTCCGTCTATGCTCGAGCATAGACGGAGAAGAAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020155.2-1117s21c1
Sequence:CCGGACAAAGGCTACCTGGTATTTGCTCGAGCAAATACCAGGTAGCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020155.2-626s1c1
Sequence:CCGGGTTCTTCACCTTGACGCTTATCTCGAGATAAGCGTCAAGGTGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020155.2-638s1c1
Sequence:CCGGGACGCTTATGAACCTCTACTTCTCGAGAAGTAGAGGTTCATAAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020155.2-1115s1c1
Sequence:CCGGGAACAAAGGCTACCTGGTATTCTCGAGAATACCAGGTAGCCTTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020155
GPR137 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 137
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000359738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020155.2-539s21c1
Sequence:CCGGCTCCTTCTACTTCCGAGATACCTCGAGGTATCTCGGAAGTAGAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020155.2-627s21c1
Sequence:CCGGTTCTTCACCTTGACGCTTATGCTCGAGCATAAGCGTCAAGGTGAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020155.2-1060s1c1
Sequence:CCGGTCGATTACGGCTGGTACAATGCTCGAGCATTGTACCAGCCGTAATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020155.2-415s1c1
Sequence:CCGGTGCTCTTCTTCTCCGTCTATGCTCGAGCATAGACGGAGAAGAAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020155.2-1117s21c1
Sequence:CCGGACAAAGGCTACCTGGTATTTGCTCGAGCAAATACCAGGTAGCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020155.2-626s1c1
Sequence:CCGGGTTCTTCACCTTGACGCTTATCTCGAGATAAGCGTCAAGGTGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020155.2-638s1c1
Sequence:CCGGGACGCTTATGAACCTCTACTTCTCGAGAAGTAGAGGTTCATAAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020155.2-1115s1c1
Sequence:CCGGGAACAAAGGCTACCTGGTATTCTCGAGAATACCAGGTAGCCTTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207220
VALIDATED
GPR137 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 137
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207220.1-544s21c1
Sequence:CCGGGTTCTTCACACTGACGCTTATCTCGAGATAAGCGTCAGTGTGAAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207220.1-1020s21c1
Sequence:CCGGTGAATGACCTAGGGAACAAAGCTCGAGCTTTGTTCCCTAGGTCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241985    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207220.1-1545s21c1
Sequence:CCGGCTCCTTGCCGCTCCTATTGTACTCGAGTACAATAGGAGCGGCAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207220.1-964s21c1
Sequence:CCGGCCGGCTAGATGCCTTCGATTACTCGAGTAATCGAAGGCATCTAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207220.1-457s21c1
Sequence:CCGGCTCCTTCTACTTCCGAGATACCTCGAGGTATCTCGGAAGTAGAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173848    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207220.1-1479s1c1
Sequence:CCGGCAAGTACGTCTGCTGCTTCTTCTCGAGAAGAAGCAGCAGACGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173264    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207220.1-547s1c1
Sequence:CCGGCTTCACACTGACGCTTATGAACTCGAGTTCATAAGCGTCAGTGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207220
VALIDATED
GPR137 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 137
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207220.1-544s21c1
Sequence:CCGGGTTCTTCACACTGACGCTTATCTCGAGATAAGCGTCAGTGTGAAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207220.1-1020s21c1
Sequence:CCGGTGAATGACCTAGGGAACAAAGCTCGAGCTTTGTTCCCTAGGTCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241985    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207220.1-1545s21c1
Sequence:CCGGCTCCTTGCCGCTCCTATTGTACTCGAGTACAATAGGAGCGGCAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207220.1-964s21c1
Sequence:CCGGCCGGCTAGATGCCTTCGATTACTCGAGTAATCGAAGGCATCTAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207220.1-457s21c1
Sequence:CCGGCTCCTTCTACTTCCGAGATACCTCGAGGTATCTCGGAAGTAGAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173848    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207220.1-1479s1c1
Sequence:CCGGCAAGTACGTCTGCTGCTTCTTCTCGAGAAGAAGCAGCAGACGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173264    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207220.1-547s1c1
Sequence:CCGGCTTCACACTGACGCTTATGAACTCGAGTTCATAAGCGTCAGTGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207220
VALIDATED
GPR137 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 137
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207220.1-544s21c1
Sequence:CCGGGTTCTTCACACTGACGCTTATCTCGAGATAAGCGTCAGTGTGAAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207220.1-1020s21c1
Sequence:CCGGTGAATGACCTAGGGAACAAAGCTCGAGCTTTGTTCCCTAGGTCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241985    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207220.1-1545s21c1
Sequence:CCGGCTCCTTGCCGCTCCTATTGTACTCGAGTACAATAGGAGCGGCAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207220.1-964s21c1
Sequence:CCGGCCGGCTAGATGCCTTCGATTACTCGAGTAATCGAAGGCATCTAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207220.1-457s21c1
Sequence:CCGGCTCCTTCTACTTCCGAGATACCTCGAGGTATCTCGGAAGTAGAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173848    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207220.1-1479s1c1
Sequence:CCGGCAAGTACGTCTGCTGCTTCTTCTCGAGAAGAAGCAGCAGACGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173264    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207220.1-547s1c1
Sequence:CCGGCTTCACACTGACGCTTATGAACTCGAGTTCATAAGCGTCAGTGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks