EMAIL THIS PAGE TO A FRIEND

GPR137B

G protein-coupled receptor 137B

104 Gene Product Result for
Synonyms: TM7SF1
UniProtKB ID: O60478, Q53EK7, Q5TAE6, Q6FHI3
Gene ID:
Mouse(83924) G protein-coupled receptor 137B
Rat(289287) G protein-coupled receptor 137B
Goat(100861105) G protein-coupled receptor 137B
sheep(101117727) G protein-coupled receptor 137B
domestic guinea pig(100730752) G protein-coupled receptor 137B
naked mole-rat(101725569) G protein-coupled receptor 137B
chicken(421511) G protein-coupled receptor 137B
cow(613826) G protein-coupled receptor 137B
Horse(100050643) G protein-coupled receptor 137B
domestic cat(101080918) G protein-coupled receptor 137B
dog(479194) G protein-coupled receptor 137B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003272 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003272 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003272 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031999 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031999 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031999 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003272 Rosetta Predictions human pricing
NM_001105978 Rosetta Predictions rat pricing
NM_031999 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003272 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146812 predicted 936
2 SASI_Hs01_00146813 predicted 1241
3 SASI_Hs01_00146814 predicted 797
4 SASI_Hs01_00146815 predicted 1048
5 SASI_Hs01_00146816 predicted 632
6 SASI_Hs01_00146817 predicted 774
7 SASI_Hs01_00146818 predicted 1260
8 SASI_Hs02_00335328 predicted 1037
9 SASI_Hs01_00146819 predicted 1175
10 SASI_Hs01_00146820 predicted 1296
11 SASI_Hs01_00146821 predicted 705
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105978 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214422 predicted 356
2 SASI_Rn02_00214423 predicted 392
3 SASI_Rn02_00214424 predicted 353
4 SASI_Rn02_00214425 predicted 555
5 SASI_Rn02_00214426 predicted 603
6 SASI_Rn02_00214427 predicted 315
7 SASI_Rn02_00214428 predicted 308
8 SASI_Rn02_00214429 predicted 584
9 SASI_Rn02_00214430 predicted 593
10 SASI_Rn02_00214431 predicted 384
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031999 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094572 predicted 672
2 SASI_Mm01_00094573 predicted 475
3 SASI_Mm01_00094574 predicted 1075
4 SASI_Mm01_00094575 predicted 832
5 SASI_Mm01_00094576 predicted 1347
6 SASI_Mm02_00337202 predicted 1352
7 SASI_Mm01_00094578 predicted 1023
8 SASI_Mm01_00094577 predicted 870
9 SASI_Mm02_00337203 predicted 1113
10 SASI_Mm02_00337204 predicted 1302
11 SASI_Mm01_00094579 predicted 702
12 SASI_Mm01_00094580 predicted 454
13 SASI_Mm01_00094581 predicted 1044
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003272
VALIDATED
GPR137B MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 137B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_003272.1-976s1c1
Sequence:CCGGGTCGTTTATTTCTTCCGAGTTCTCGAGAACTCGGAAGAAATAAACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_003272.1-924s1c1
Sequence:CCGGCGTATTATTTGGAGTGGTGTTCTCGAGAACACCACTCCAAATAATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003272.1-1724s1c1
Sequence:CCGGCCACATTGGTAGACTCCTAAACTCGAGTTTAGGAGTCTACCAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003272.1-964s1c1
Sequence:CCGGCCTACCACCTTAGTCGTTTATCTCGAGATAAACGACTAAGGTGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003272.1-1198s1c1
Sequence:CCGGGCAGGAACTTTGCAAGACTCACTCGAGTGAGTCTTGCAAAGTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003272.1-333s1c1
Sequence:CCGGCCTCTTCTCCTTCTACTTCAACTCGAGTTGAAGTAGAAGGAGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003272.1-438s1c1
Sequence:CCGGCACGCTGATGAACTTGTACTTCTCGAGAAGTACAAGTTCATCAGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003272.3-1005s21c1
Sequence:CCGGCTACCACCTTAGTCGTTTATTCTCGAGAATAAACGACTAAGGTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003272.3-1087s21c1
Sequence:CCGGATTCAGTCCCAGATCTTATTTCTCGAGAAATAAGATCTGGGACTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003272.3-951s21c1
Sequence:CCGGGAGATGCTGGATACGTATTATCTCGAGATAATACGTATCCAGCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003272
VALIDATED
GPR137B MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 137B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_003272.1-976s1c1
Sequence:CCGGGTCGTTTATTTCTTCCGAGTTCTCGAGAACTCGGAAGAAATAAACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_003272.1-924s1c1
Sequence:CCGGCGTATTATTTGGAGTGGTGTTCTCGAGAACACCACTCCAAATAATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003272.1-1724s1c1
Sequence:CCGGCCACATTGGTAGACTCCTAAACTCGAGTTTAGGAGTCTACCAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003272.1-964s1c1
Sequence:CCGGCCTACCACCTTAGTCGTTTATCTCGAGATAAACGACTAAGGTGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003272.1-1198s1c1
Sequence:CCGGGCAGGAACTTTGCAAGACTCACTCGAGTGAGTCTTGCAAAGTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003272.1-333s1c1
Sequence:CCGGCCTCTTCTCCTTCTACTTCAACTCGAGTTGAAGTAGAAGGAGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003272.1-438s1c1
Sequence:CCGGCACGCTGATGAACTTGTACTTCTCGAGAAGTACAAGTTCATCAGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003272.3-1005s21c1
Sequence:CCGGCTACCACCTTAGTCGTTTATTCTCGAGAATAAACGACTAAGGTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003272.3-1087s21c1
Sequence:CCGGATTCAGTCCCAGATCTTATTTCTCGAGAAATAAGATCTGGGACTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003272.3-951s21c1
Sequence:CCGGGAGATGCTGGATACGTATTATCTCGAGATAATACGTATCCAGCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003272
VALIDATED
GPR137B MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 137B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_003272.1-976s1c1
Sequence:CCGGGTCGTTTATTTCTTCCGAGTTCTCGAGAACTCGGAAGAAATAAACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_003272.1-924s1c1
Sequence:CCGGCGTATTATTTGGAGTGGTGTTCTCGAGAACACCACTCCAAATAATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003272.1-1724s1c1
Sequence:CCGGCCACATTGGTAGACTCCTAAACTCGAGTTTAGGAGTCTACCAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003272.1-964s1c1
Sequence:CCGGCCTACCACCTTAGTCGTTTATCTCGAGATAAACGACTAAGGTGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003272.1-1198s1c1
Sequence:CCGGGCAGGAACTTTGCAAGACTCACTCGAGTGAGTCTTGCAAAGTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003272.1-333s1c1
Sequence:CCGGCCTCTTCTCCTTCTACTTCAACTCGAGTTGAAGTAGAAGGAGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003272.1-438s1c1
Sequence:CCGGCACGCTGATGAACTTGTACTTCTCGAGAAGTACAAGTTCATCAGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003272.3-1005s21c1
Sequence:CCGGCTACCACCTTAGTCGTTTATTCTCGAGAATAAACGACTAAGGTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003272.3-1087s21c1
Sequence:CCGGATTCAGTCCCAGATCTTATTTCTCGAGAAATAAGATCTGGGACTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003272.3-951s21c1
Sequence:CCGGGAGATGCTGGATACGTATTATCTCGAGATAATACGTATCCAGCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031999
VALIDATED
GPR137B MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 137B
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031999.1-1207s1c1
Sequence:CCGGGCATCAAGACTCCACTTTGGACTCGAGTCCAAAGTGGAGTCTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031999.1-497s1c1
Sequence:CCGGGAGCTACTCAAATACCGGTTACTCGAGTAACCGGTATTTGAGTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243489    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_031999.2-2700s21c1
Sequence:CCGGTCACCATACCTGCAATGATTTCTCGAGAAATCATTGCAGGTATGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031999.2-464s21c1
Sequence:CCGGCTTCACCCTCACGCTCATGAACTCGAGTTCATGAGCGTGAGGGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_031999.2-249s21c1
Sequence:CCGGCTCCTCTTCGTGTTCATCTATCTCGAGATAGATGAACACGAAGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031999.2-475s21c1
Sequence:CCGGCGCTCATGAACTTGTACTTCACTCGAGTGAAGTACAAGTTCATGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_031999.2-447s21c1
Sequence:CCGGCCCGTGTGTCTACAGTTCTTCCTCGAGGAAGAACTGTAGACACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031999
VALIDATED
GPR137B MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 137B
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031999.1-1207s1c1
Sequence:CCGGGCATCAAGACTCCACTTTGGACTCGAGTCCAAAGTGGAGTCTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031999.1-497s1c1
Sequence:CCGGGAGCTACTCAAATACCGGTTACTCGAGTAACCGGTATTTGAGTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243489    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_031999.2-2700s21c1
Sequence:CCGGTCACCATACCTGCAATGATTTCTCGAGAAATCATTGCAGGTATGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031999.2-464s21c1
Sequence:CCGGCTTCACCCTCACGCTCATGAACTCGAGTTCATGAGCGTGAGGGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_031999.2-249s21c1
Sequence:CCGGCTCCTCTTCGTGTTCATCTATCTCGAGATAGATGAACACGAAGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031999.2-475s21c1
Sequence:CCGGCGCTCATGAACTTGTACTTCACTCGAGTGAAGTACAAGTTCATGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_031999.2-447s21c1
Sequence:CCGGCCCGTGTGTCTACAGTTCTTCCTCGAGGAAGAACTGTAGACACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031999
VALIDATED
GPR137B MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 137B
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031999.1-1207s1c1
Sequence:CCGGGCATCAAGACTCCACTTTGGACTCGAGTCCAAAGTGGAGTCTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031999.1-497s1c1
Sequence:CCGGGAGCTACTCAAATACCGGTTACTCGAGTAACCGGTATTTGAGTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243489    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_031999.2-2700s21c1
Sequence:CCGGTCACCATACCTGCAATGATTTCTCGAGAAATCATTGCAGGTATGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031999.2-464s21c1
Sequence:CCGGCTTCACCCTCACGCTCATGAACTCGAGTTCATGAGCGTGAGGGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_031999.2-249s21c1
Sequence:CCGGCTCCTCTTCGTGTTCATCTATCTCGAGATAGATGAACACGAAGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031999.2-475s21c1
Sequence:CCGGCGCTCATGAACTTGTACTTCACTCGAGTGAAGTACAAGTTCATGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_031999.2-447s21c1
Sequence:CCGGCCCGTGTGTCTACAGTTCTTCCTCGAGGAAGAACTGTAGACACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks