EMAIL THIS PAGE TO A FRIEND

GPR137C

G protein-coupled receptor 137C

207 Gene Product Result for
Synonyms: TM7SF1L2
UniProtKB ID: Q8N3F9, Q86SM2
Gene ID:
Mouse(70713) G protein-coupled receptor 137C
Rat(305812) G protein-coupled receptor 137C
chicken(428932) G protein-coupled receptor 137C
dog(612969) G protein-coupled receptor 137C
Horse(100054651) G protein-coupled receptor 137C
cow(616594) G protein-coupled receptor 137C
domestic cat(101090366) G protein-coupled receptor 137C
sheep(101116655) G protein-coupled receptor 137C
domestic guinea pig(100731939) G protein-coupled receptor 137C
naked mole-rat(101717003) G protein-coupled receptor 137C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001099652 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001099652 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001099652 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027518 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027518 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027518 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099652 Rosetta Predictions human pricing
XM_290615 Rosetta Predictions human pricing
NM_001134541 Rosetta Predictions rat pricing
NM_027518 Rosetta Predictions mouse pricing
XM_354808 Rosetta Predictions mouse pricing
XM_986046 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099652 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320883 predicted 602
2 SASI_Hs02_00320884 predicted 1011
3 SASI_Hs02_00320885 predicted 714
4 SASI_Hs02_00320886 predicted 1101
5 SASI_Hs02_00320887 predicted 853
6 SASI_Hs02_00320888 predicted 1298
7 SASI_Hs02_00320889 predicted 845
8 SASI_Hs02_00320890 predicted 1202
9 SASI_Hs02_00320891 predicted 1250
10 SASI_Hs02_00320892 predicted 808
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_290615 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00253247 predicted 1912
2 SASI_Hs01_00253248 predicted 347
3 SASI_Hs01_00253249 predicted 2001
4 SASI_Hs01_00253250 predicted 2201
5 SASI_Hs01_00253251 predicted 2107
6 SASI_Hs01_00253252 predicted 2144
7 SASI_Hs01_00253253 predicted 488
8 SASI_Hs01_00253254 predicted 2248
9 SASI_Hs01_00253255 predicted 2241
10 SASI_Hs01_00253256 predicted 2133
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134541 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256899 predicted 599
2 SASI_Rn02_00256900 predicted 667
3 SASI_Rn02_00256901 predicted 555
4 SASI_Rn02_00256902 predicted 898
5 SASI_Rn02_00256903 predicted 705
6 SASI_Rn02_00256904 predicted 534
7 SASI_Rn02_00256905 predicted 768
8 SASI_Rn02_00256906 predicted 565
9 SASI_Rn02_00256907 predicted 552
10 SASI_Rn02_00256908 predicted 565
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027518 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062185 predicted 806
2 SASI_Mm01_00062186 predicted 941
3 SASI_Mm01_00062187 predicted 692
4 SASI_Mm01_00062188 predicted 1300
5 SASI_Mm01_00062189 predicted 1294
6 SASI_Mm01_00062190 predicted 1197
7 SASI_Mm01_00062191 predicted 1336
8 SASI_Mm01_00062192 predicted 833
9 SASI_Mm01_00062193 predicted 1207
10 SASI_Mm01_00062194 predicted 1129
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_354808 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00425761 predicted 929
2 SASI_Mm02_00425762 predicted 848
3 SASI_Mm02_00425763 predicted 506
4 SASI_Mm02_00425764 predicted 363
5 SASI_Mm02_00425765 predicted 972
6 SASI_Mm02_00425766 predicted 954
7 SASI_Mm02_00425767 predicted 269
8 SASI_Mm02_00425768 predicted 386
9 SASI_Mm02_00425769 predicted 468
10 SASI_Mm02_00425770 predicted 836
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_986046 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00231110 predicted 206
2 SASI_Mm02_00448948 predicted 303
3 SASI_Mm01_00231111 predicted 288
4 SASI_Mm01_00231112 predicted 307
5 SASI_Mm01_00231113 predicted 422
6 SASI_Mm01_00231114 predicted 310
7 SASI_Mm01_00231115 predicted 241
8 SASI_Mm01_00231117 predicted 220
9 SASI_Mm01_00231118 predicted 260
10 SASI_Mm01_00231119 predicted 299
11 SASI_Mm01_00231116 predicted 218
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099652
GPR137C MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 137C
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099652.1-805s21c1
Sequence:CCGGACCATATCTCAGGATACATTACTCGAGTAATGTATCCTGAGATATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099652.1-1877s21c1
Sequence:CCGGTGGTAGTAATCCATTAGTTATCTCGAGATAACTAATGGATTACTACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099652.1-743s21c1
Sequence:CCGGTCGTGGGCTCTGTAGTCATTCCTCGAGGAATGACTACAGAGCCCACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099652.1-1045s21c1
Sequence:CCGGTTCGACAATCCAAGACGATATCTCGAGATATCGTCTTGGATTGTCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099652.1-431s21c1
Sequence:CCGGTCTACCTGGCGGAGGTTATATCTCGAGATATAACCTCCGCCAGGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099652
GPR137C MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 137C
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099652.1-805s21c1
Sequence:CCGGACCATATCTCAGGATACATTACTCGAGTAATGTATCCTGAGATATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099652.1-1877s21c1
Sequence:CCGGTGGTAGTAATCCATTAGTTATCTCGAGATAACTAATGGATTACTACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099652.1-743s21c1
Sequence:CCGGTCGTGGGCTCTGTAGTCATTCCTCGAGGAATGACTACAGAGCCCACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099652.1-1045s21c1
Sequence:CCGGTTCGACAATCCAAGACGATATCTCGAGATATCGTCTTGGATTGTCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099652.1-431s21c1
Sequence:CCGGTCTACCTGGCGGAGGTTATATCTCGAGATATAACCTCCGCCAGGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099652
GPR137C MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 137C
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099652.1-805s21c1
Sequence:CCGGACCATATCTCAGGATACATTACTCGAGTAATGTATCCTGAGATATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099652.1-1877s21c1
Sequence:CCGGTGGTAGTAATCCATTAGTTATCTCGAGATAACTAATGGATTACTACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099652.1-743s21c1
Sequence:CCGGTCGTGGGCTCTGTAGTCATTCCTCGAGGAATGACTACAGAGCCCACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099652.1-1045s21c1
Sequence:CCGGTTCGACAATCCAAGACGATATCTCGAGATATCGTCTTGGATTGTCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099652.1-431s21c1
Sequence:CCGGTCTACCTGGCGGAGGTTATATCTCGAGATATAACCTCCGCCAGGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027518
GPR137C MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 137C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027518.1-3056s1c1
Sequence:CCGGGCTGGAAGAATGCCATGATTTCTCGAGAAATCATGGCATTCTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027518.1-829s1c1
Sequence:CCGGTCTTTCCCTCTCCCTCAACTTCTCGAGAAGTTGAGGGAGAGGGAAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027518.1-657s1c1
Sequence:CCGGGCCTACAGTTCTCCACGCTCTCTCGAGAGAGCGTGGAGAACTGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027518.1-601s1c1
Sequence:CCGGGCCACCCTCTCGCCTGCACTTCTCGAGAAGTGCAGGCGAGAGGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027518.1-432s1c1
Sequence:CCGGCCGCGCTCTTCGCCTTTGCCTCTCGAGAGGCAAAGGCGAAGAGCGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027518
GPR137C MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 137C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027518.1-3056s1c1
Sequence:CCGGGCTGGAAGAATGCCATGATTTCTCGAGAAATCATGGCATTCTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027518.1-829s1c1
Sequence:CCGGTCTTTCCCTCTCCCTCAACTTCTCGAGAAGTTGAGGGAGAGGGAAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027518.1-657s1c1
Sequence:CCGGGCCTACAGTTCTCCACGCTCTCTCGAGAGAGCGTGGAGAACTGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027518.1-601s1c1
Sequence:CCGGGCCACCCTCTCGCCTGCACTTCTCGAGAAGTGCAGGCGAGAGGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027518.1-432s1c1
Sequence:CCGGCCGCGCTCTTCGCCTTTGCCTCTCGAGAGGCAAAGGCGAAGAGCGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027518
GPR137C MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 137C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027518.1-3056s1c1
Sequence:CCGGGCTGGAAGAATGCCATGATTTCTCGAGAAATCATGGCATTCTTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027518.1-829s1c1
Sequence:CCGGTCTTTCCCTCTCCCTCAACTTCTCGAGAAGTTGAGGGAGAGGGAAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027518.1-657s1c1
Sequence:CCGGGCCTACAGTTCTCCACGCTCTCTCGAGAGAGCGTGGAGAACTGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027518.1-601s1c1
Sequence:CCGGGCCACCCTCTCGCCTGCACTTCTCGAGAAGTGCAGGCGAGAGGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027518.1-432s1c1
Sequence:CCGGCCGCGCTCTTCGCCTTTGCCTCTCGAGAGGCAAAGGCGAAGAGCGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)