EMAIL THIS PAGE TO A FRIEND

GPR139

G protein-coupled receptor 139

49 Gene Product Result for
Synonyms: GPRg1 PGR3
UniProtKB ID: Q6DWJ6, A8K5R9, Q86SP2, Q8TDU8
Gene ID:
Mouse(209776) G protein-coupled receptor 139
Rat(293545) G protein-coupled receptor 139
domestic guinea pig(100734197) G protein-coupled receptor 139
naked mole-rat(101708344) G protein-coupled receptor 139
sheep(101118916) G protein-coupled receptor 139
Zebrafish(613138) G protein-coupled receptor 139
chicken(431418) G protein-coupled receptor 139
dog(489988) G protein-coupled receptor 139
Horse(100049812) G protein-coupled receptor 139
cow(540680) G protein-coupled receptor 139
domestic cat(101084925) G protein-coupled receptor 139
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA046596 Anti-GPR139 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4500335 Anti-GPR139 antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence pricing
SAB2900525 Anti-GPR139 antibody produced in rabbit affinity isolated antibody dog, human, bovine, rabbit, chicken, horse, monkey, mouse, rat
immunohistochemistry pricing
SAB2900526 Anti-GPR139 antibody produced in rabbit affinity isolated antibody chicken, rat, dog, horse, hamster, pig, monkey, rabbit, human, bovine, mouse
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001002911 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001002911 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001002911 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001024138 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001024138 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001024138 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002911 Rosetta Predictions human pricing
NM_001024241 Rosetta Predictions rat pricing
NM_001024138 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002911 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148142 predicted 612
2 SASI_Hs01_00148143 predicted 572
3 SASI_Hs01_00148144 predicted 760
4 SASI_Hs01_00148145 predicted 499
5 SASI_Hs01_00148146 predicted 593
6 SASI_Hs01_00148147 predicted 503
7 SASI_Hs01_00148148 predicted 330
8 SASI_Hs01_00148149 predicted 517
9 SASI_Hs01_00148150 predicted 882
10 SASI_Hs01_00148151 predicted 525
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024241 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111712 predicted 463
2 SASI_Rn02_00202389 predicted 510
3 SASI_Rn01_00111713 predicted 781
4 SASI_Rn01_00111714 predicted 571
5 SASI_Rn02_00202390 predicted 478
6 SASI_Rn01_00111715 predicted 297
7 SASI_Rn01_00111716 predicted 312
8 SASI_Rn01_00111717 predicted 214
9 SASI_Rn01_00111718 predicted 403
10 SASI_Rn01_00111719 predicted 274
11 SASI_Rn01_00111710 predicted 361
12 SASI_Rn01_00111711 predicted 752
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024138 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035606 predicted 340
2 SASI_Mm01_00035607 predicted 412
3 SASI_Mm01_00035608 predicted 752
4 SASI_Mm01_00035609 predicted 468
5 SASI_Mm01_00035610 predicted 419
6 SASI_Mm01_00035611 predicted 264
7 SASI_Mm01_00035612 predicted 265
8 SASI_Mm01_00035613 predicted 583
9 SASI_Mm01_00035614 predicted 214
10 SASI_Mm01_00035615 predicted 470
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002911
GPR139 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 139
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002911.1-204s1c1
Sequence:CCGGGCCTCGGTTTACCAGCAAATACTCGAGTATTTGCTGGTAAACCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002911.1-718s1c1
Sequence:CCGGGCTCAGGAGGAAGAGCAATTTCTCGAGAAATTGCTCTTCCTCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002911.1-452s1c1
Sequence:CCGGCCGTTAACCATTGACAGGTATCTCGAGATACCTGTCAATGGTTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002911.1-819s1c1
Sequence:CCGGCCCGCATCATCATGATTCTTTCTCGAGAAAGAATCATGATGATGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002911.1-522s1c1
Sequence:CCGGGCACCCGGAAAGTCATTGTAACTCGAGTTACAATGACTTTCCGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002911.2-950s21c1
Sequence:CCGGTACACATCATGTCCGACATTGCTCGAGCAATGTCGGACATGATGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002911.2-891s21c1
Sequence:CCGGCCGCATCATCATGATTCTTTACTCGAGTAAAGAATCATGATGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002911.2-525s21c1
Sequence:CCGGGTTAACCATTGACAGGTATATCTCGAGATATACCTGTCAATGGTTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002911
GPR139 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 139
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002911.1-204s1c1
Sequence:CCGGGCCTCGGTTTACCAGCAAATACTCGAGTATTTGCTGGTAAACCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002911.1-718s1c1
Sequence:CCGGGCTCAGGAGGAAGAGCAATTTCTCGAGAAATTGCTCTTCCTCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002911.1-452s1c1
Sequence:CCGGCCGTTAACCATTGACAGGTATCTCGAGATACCTGTCAATGGTTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002911.1-819s1c1
Sequence:CCGGCCCGCATCATCATGATTCTTTCTCGAGAAAGAATCATGATGATGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002911.1-522s1c1
Sequence:CCGGGCACCCGGAAAGTCATTGTAACTCGAGTTACAATGACTTTCCGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002911.2-950s21c1
Sequence:CCGGTACACATCATGTCCGACATTGCTCGAGCAATGTCGGACATGATGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002911.2-891s21c1
Sequence:CCGGCCGCATCATCATGATTCTTTACTCGAGTAAAGAATCATGATGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002911.2-525s21c1
Sequence:CCGGGTTAACCATTGACAGGTATATCTCGAGATATACCTGTCAATGGTTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002911
GPR139 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 139
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002911.1-204s1c1
Sequence:CCGGGCCTCGGTTTACCAGCAAATACTCGAGTATTTGCTGGTAAACCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002911.1-718s1c1
Sequence:CCGGGCTCAGGAGGAAGAGCAATTTCTCGAGAAATTGCTCTTCCTCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002911.1-452s1c1
Sequence:CCGGCCGTTAACCATTGACAGGTATCTCGAGATACCTGTCAATGGTTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002911.1-819s1c1
Sequence:CCGGCCCGCATCATCATGATTCTTTCTCGAGAAAGAATCATGATGATGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002911.1-522s1c1
Sequence:CCGGGCACCCGGAAAGTCATTGTAACTCGAGTTACAATGACTTTCCGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002911.2-950s21c1
Sequence:CCGGTACACATCATGTCCGACATTGCTCGAGCAATGTCGGACATGATGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002911.2-891s21c1
Sequence:CCGGCCGCATCATCATGATTCTTTACTCGAGTAAAGAATCATGATGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002911.2-525s21c1
Sequence:CCGGGTTAACCATTGACAGGTATATCTCGAGATATACCTGTCAATGGTTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024138
GPR139 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 139
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000178634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024138.1-339s1c1
Sequence:CCGGCTTAACGGTTGACAGGTATATCTCGAGATATACCTGTCAACCGTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024138.1-277s1c1
Sequence:CCGGGACAAGATCATAGAAGTTCTACTCGAGTAGAACTTCTATGATCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024138.1-666s1c1
Sequence:CCGGGTTTACCATTACCTCCATCTTCTCGAGAAGATGGAGGTAATGGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024138.1-819s1c1
Sequence:CCGGCTTCTTTCTCTACTGCTTCATCTCGAGATGAAGCAGTAGAGAAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200161    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024138.1-90s1c1
Sequence:CCGGCCTCGGGTTACCAGCAAATATCTCGAGATATTTGCTGGTAACCCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024138.1-603s1c1
Sequence:CCGGGCTTAGGAGAAAGAGCAATTTCTCGAGAAATTGCTCTTTCTCCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198117    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024138.1-579s1c1
Sequence:CCGGCTTGAACTCCATCATTGTGTACTCGAGTACACAATGATGGAGTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198583    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024138.1-771s1c1
Sequence:CCGGCATGTTGGATGTTGCCAACATCTCGAGATGTTGGCAACATCCAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024138.1-362s1c1
Sequence:CCGGCTGTCTGTCACCCACTCAAATCTCGAGATTTGAGTGGGTGACAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024138
GPR139 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 139
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000178634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024138.1-339s1c1
Sequence:CCGGCTTAACGGTTGACAGGTATATCTCGAGATATACCTGTCAACCGTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024138.1-277s1c1
Sequence:CCGGGACAAGATCATAGAAGTTCTACTCGAGTAGAACTTCTATGATCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024138.1-666s1c1
Sequence:CCGGGTTTACCATTACCTCCATCTTCTCGAGAAGATGGAGGTAATGGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024138.1-819s1c1
Sequence:CCGGCTTCTTTCTCTACTGCTTCATCTCGAGATGAAGCAGTAGAGAAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200161    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024138.1-90s1c1
Sequence:CCGGCCTCGGGTTACCAGCAAATATCTCGAGATATTTGCTGGTAACCCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024138.1-603s1c1
Sequence:CCGGGCTTAGGAGAAAGAGCAATTTCTCGAGAAATTGCTCTTTCTCCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198117    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024138.1-579s1c1
Sequence:CCGGCTTGAACTCCATCATTGTGTACTCGAGTACACAATGATGGAGTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198583    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024138.1-771s1c1
Sequence:CCGGCATGTTGGATGTTGCCAACATCTCGAGATGTTGGCAACATCCAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024138.1-362s1c1
Sequence:CCGGCTGTCTGTCACCCACTCAAATCTCGAGATTTGAGTGGGTGACAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024138
GPR139 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 139
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000178634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024138.1-339s1c1
Sequence:CCGGCTTAACGGTTGACAGGTATATCTCGAGATATACCTGTCAACCGTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024138.1-277s1c1
Sequence:CCGGGACAAGATCATAGAAGTTCTACTCGAGTAGAACTTCTATGATCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024138.1-666s1c1
Sequence:CCGGGTTTACCATTACCTCCATCTTCTCGAGAAGATGGAGGTAATGGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024138.1-819s1c1
Sequence:CCGGCTTCTTTCTCTACTGCTTCATCTCGAGATGAAGCAGTAGAGAAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200161    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024138.1-90s1c1
Sequence:CCGGCCTCGGGTTACCAGCAAATATCTCGAGATATTTGCTGGTAACCCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024138.1-603s1c1
Sequence:CCGGGCTTAGGAGAAAGAGCAATTTCTCGAGAAATTGCTCTTTCTCCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198117    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024138.1-579s1c1
Sequence:CCGGCTTGAACTCCATCATTGTGTACTCGAGTACACAATGATGGAGTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198583    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024138.1-771s1c1
Sequence:CCGGCATGTTGGATGTTGCCAACATCTCGAGATGTTGGCAACATCCAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024138.1-362s1c1
Sequence:CCGGCTGTCTGTCACCCACTCAAATCTCGAGATTTGAGTGGGTGACAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks