EMAIL THIS PAGE TO A FRIEND

GPR141

G protein-coupled receptor 141

49 Gene Product Result for
Synonyms: PGR13
UniProtKB ID: Q7Z602, A4D1X7, Q0VAR5, Q86SP3
Gene ID:
Human(353345) Summary: GPR141 is a member of the rhodopsin family of G protein-coupled receptors (GPRs) (Fredriksson et al., 2003 [PubMed 14623098]
Mouse(353346) G protein-coupled receptor 141
Rat(291179) G protein-coupled receptor 141
chicken(420733) G protein-coupled receptor 141
cow(784535) G protein-coupled receptor 141
domestic cat(101081372) G protein-coupled receptor 141
dog(482403) G protein-coupled receptor 141
sheep(101114515) G protein-coupled receptor 141
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181791 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181791 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181791 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181754 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181754 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181754 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181791 Rosetta Predictions human pricing
NM_181767 Rosetta Predictions rat pricing
NM_181754 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181791 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117538 predicted 460
2 SASI_Hs02_00370397 predicted 562
3 SASI_Hs01_00117539 predicted 571
4 SASI_Hs01_00117540 predicted 362
5 SASI_Hs01_00117541 predicted 442
6 SASI_Hs01_00117542 predicted 510
7 SASI_Hs02_00370398 predicted 212
8 SASI_Hs01_00117544 predicted 538
9 SASI_Hs02_00370399 predicted 406
10 SASI_Hs01_00117546 predicted 509
11 SASI_Hs01_00117543 predicted 341
12 SASI_Hs01_00117545 predicted 409
13 SASI_Hs01_00117547 predicted 299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181767 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042252 predicted 444
2 SASI_Rn01_00042253 predicted 386
3 SASI_Rn01_00042254 predicted 311
4 SASI_Rn02_00269789 predicted 449
5 SASI_Rn01_00042255 predicted 270
6 SASI_Rn01_00042257 predicted 241
7 SASI_Rn02_00269790 predicted 201
8 SASI_Rn01_00042258 predicted 455
9 SASI_Rn01_00042260 predicted 231
10 SASI_Rn01_00042261 predicted 463
11 SASI_Rn01_00042256 predicted 451
12 SASI_Rn01_00042259 predicted 283
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181754 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184631 predicted 1024
2 SASI_Mm01_00184632 predicted 1000
3 SASI_Mm01_00184633 predicted 573
4 SASI_Mm01_00184634 predicted 1406
5 SASI_Mm01_00184635 predicted 1116
6 SASI_Mm01_00184636 predicted 1077
7 SASI_Mm01_00184637 predicted 1259
8 SASI_Mm01_00184638 predicted 845
9 SASI_Mm01_00184639 predicted 876
10 SASI_Mm02_00349923 predicted 1040
11 SASI_Mm01_00184630 predicted 777
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181791
GPR141 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 141
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181791.1-67s21c1
Sequence:CCGGCTCTACTTCATAGTGCTTATTCTCGAGAATAAGCACTATGAAGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181791.1-722s21c1
Sequence:CCGGACCAGTTCTTTAGGATCTATTCTCGAGAATAGATCCTAAAGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181791.1-150s21c1
Sequence:CCGGGACCACCATGGCGGTCATTAACTCGAGTTAATGACCGCCATGGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181791.1-54s1c1
Sequence:CCGGCCACTTAATCAGCCTCTACTTCTCGAGAAGTAGAGGCTGATTAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181791.1-66s1c1
Sequence:CCGGCCTCTACTTCATAGTGCTTATCTCGAGATAAGCACTATGAAGTAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181791.1-306s1c1
Sequence:CCGGGTTCCTATTCTATGTGGTGATCTCGAGATCACCACATAGAATAGGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181791.1-723s1c1
Sequence:CCGGCCAGTTCTTTAGGATCTATTACTCGAGTAATAGATCCTAAAGAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181791.1-597s1c1
Sequence:CCGGCCAGGTCTTCATCATTATGTTCTCGAGAACATAATGATGAAGACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181791
GPR141 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 141
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181791.1-67s21c1
Sequence:CCGGCTCTACTTCATAGTGCTTATTCTCGAGAATAAGCACTATGAAGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181791.1-722s21c1
Sequence:CCGGACCAGTTCTTTAGGATCTATTCTCGAGAATAGATCCTAAAGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181791.1-150s21c1
Sequence:CCGGGACCACCATGGCGGTCATTAACTCGAGTTAATGACCGCCATGGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181791.1-54s1c1
Sequence:CCGGCCACTTAATCAGCCTCTACTTCTCGAGAAGTAGAGGCTGATTAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181791.1-66s1c1
Sequence:CCGGCCTCTACTTCATAGTGCTTATCTCGAGATAAGCACTATGAAGTAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181791.1-306s1c1
Sequence:CCGGGTTCCTATTCTATGTGGTGATCTCGAGATCACCACATAGAATAGGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181791.1-723s1c1
Sequence:CCGGCCAGTTCTTTAGGATCTATTACTCGAGTAATAGATCCTAAAGAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181791.1-597s1c1
Sequence:CCGGCCAGGTCTTCATCATTATGTTCTCGAGAACATAATGATGAAGACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181791
GPR141 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 141
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181791.1-67s21c1
Sequence:CCGGCTCTACTTCATAGTGCTTATTCTCGAGAATAAGCACTATGAAGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181791.1-722s21c1
Sequence:CCGGACCAGTTCTTTAGGATCTATTCTCGAGAATAGATCCTAAAGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181791.1-150s21c1
Sequence:CCGGGACCACCATGGCGGTCATTAACTCGAGTTAATGACCGCCATGGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181791.1-54s1c1
Sequence:CCGGCCACTTAATCAGCCTCTACTTCTCGAGAAGTAGAGGCTGATTAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181791.1-66s1c1
Sequence:CCGGCCTCTACTTCATAGTGCTTATCTCGAGATAAGCACTATGAAGTAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181791.1-306s1c1
Sequence:CCGGGTTCCTATTCTATGTGGTGATCTCGAGATCACCACATAGAATAGGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181791.1-723s1c1
Sequence:CCGGCCAGTTCTTTAGGATCTATTACTCGAGTAATAGATCCTAAAGAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181791.1-597s1c1
Sequence:CCGGCCAGGTCTTCATCATTATGTTCTCGAGAACATAATGATGAAGACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181754
GPR141 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 141
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181754.1-757s1c1
Sequence:CCGGGCACATTCCAAGAGCTGTAAACTCGAGTTTACAGCTCTTGGAATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181754.1-521s1c1
Sequence:CCGGGCCATGATTCTGTGCGAGTTACTCGAGTAACTCGCACAGAATCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181754.1-357s1c1
Sequence:CCGGGCGTAGAGACAAAGTAGAATTCTCGAGAATTCTACTTTGTCTCTACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181754.1-445s1c1
Sequence:CCGGCCCTTGGTGGTTTCTCAGTATCTCGAGATACTGAGAAACCACCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181754.1-54s1c1
Sequence:CCGGCCACTTAACATCGATTTACTTCTCGAGAAGTAAATCGATGTTAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181754
GPR141 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 141
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181754.1-757s1c1
Sequence:CCGGGCACATTCCAAGAGCTGTAAACTCGAGTTTACAGCTCTTGGAATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181754.1-521s1c1
Sequence:CCGGGCCATGATTCTGTGCGAGTTACTCGAGTAACTCGCACAGAATCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181754.1-357s1c1
Sequence:CCGGGCGTAGAGACAAAGTAGAATTCTCGAGAATTCTACTTTGTCTCTACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181754.1-445s1c1
Sequence:CCGGCCCTTGGTGGTTTCTCAGTATCTCGAGATACTGAGAAACCACCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181754.1-54s1c1
Sequence:CCGGCCACTTAACATCGATTTACTTCTCGAGAAGTAAATCGATGTTAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181754
GPR141 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 141
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181754.1-757s1c1
Sequence:CCGGGCACATTCCAAGAGCTGTAAACTCGAGTTTACAGCTCTTGGAATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181754.1-521s1c1
Sequence:CCGGGCCATGATTCTGTGCGAGTTACTCGAGTAACTCGCACAGAATCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181754.1-357s1c1
Sequence:CCGGGCGTAGAGACAAAGTAGAATTCTCGAGAATTCTACTTTGTCTCTACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181754.1-445s1c1
Sequence:CCGGCCCTTGGTGGTTTCTCAGTATCTCGAGATACTGAGAAACCACCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181754.1-54s1c1
Sequence:CCGGCCACTTAACATCGATTTACTTCTCGAGAAGTAAATCGATGTTAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks