EMAIL THIS PAGE TO A FRIEND

GPR142

G protein-coupled receptor 142

57 Gene Product Result for
Synonyms: PGR2
UniProtKB ID: Q7Z601, A4CYJ8, Q86SL3
Gene ID:
Human(350383) Summary: GPR142 is a member of the rhodopsin family of G protein-coupled receptors (GPRs) (Fredriksson et al., 2003 [PubMed 14623098]
Mouse(217302) G protein-coupled receptor 142
Rat(501735) G protein-coupled receptor 142
domestic guinea pig(100725010) G protein-coupled receptor 142
naked mole-rat(101715312) G protein-coupled receptor 142
sheep(101105673) G protein-coupled receptor 142
chicken(431405) G protein-coupled receptor 142
dog(483287) G protein-coupled receptor 142
cow(538511) G protein-coupled receptor 142
domestic cat(101088197) G protein-coupled receptor 142
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181749 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181749 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181749 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_181790 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181790 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181790 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU053761 MISSION® esiRNA esiRNA targeting mouse Gpr142 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181790 Rosetta Predictions human pricing
XM_001081645 Rosetta Predictions rat pricing
XM_577136 Rosetta Predictions rat pricing
NM_181749 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181790 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082478 predicted 466
2 SASI_Hs01_00082479 predicted 918
3 SASI_Hs01_00082480 predicted 586
4 SASI_Hs01_00082482 predicted 925
5 SASI_Hs01_00082483 predicted 940
6 SASI_Hs01_00082484 predicted 679
7 SASI_Hs01_00082485 predicted 988
8 SASI_Hs01_00082486 predicted 214
9 SASI_Hs01_00082487 predicted 737
10 SASI_Hs02_00370396 predicted 987
11 SASI_Hs01_00082481 predicted 248
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081645 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00372818 predicted 1549
2 SASI_Rn02_00372819 predicted 1546
3 SASI_Rn02_00372820 predicted 947
4 SASI_Rn02_00372821 predicted 946
5 SASI_Rn02_00372822 predicted 1083
6 SASI_Rn02_00372823 predicted 1245
7 SASI_Rn02_00372824 predicted 696
8 SASI_Rn02_00372825 predicted 718
9 SASI_Rn02_00372826 predicted 613
10 SASI_Rn02_00372827 predicted 1310
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577136 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00406249 predicted 1548
2 SASI_Rn02_00406250 predicted 1546
3 SASI_Rn02_00406251 predicted 948
4 SASI_Rn02_00406252 predicted 948
5 SASI_Rn02_00406253 predicted 1085
6 SASI_Rn02_00406254 predicted 1245
7 SASI_Rn02_00406255 predicted 695
8 SASI_Rn02_00406256 predicted 724
9 SASI_Rn02_00406257 predicted 618
10 SASI_Rn02_00406258 predicted 1309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181749 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169595 predicted 414
2 SASI_Mm01_00169597 predicted 844
3 SASI_Mm01_00169598 predicted 829
4 SASI_Mm01_00169599 predicted 195
5 SASI_Mm01_00169602 predicted 713
6 SASI_Mm02_00349908 predicted 199
7 SASI_Mm02_00349909 predicted 633
8 SASI_Mm01_00169603 predicted 293
9 SASI_Mm02_00349910 predicted 453
10 SASI_Mm02_00349911 predicted 837
11 SASI_Mm01_00169596 predicted 310
12 SASI_Mm01_00169600 predicted 679
13 SASI_Mm01_00169601 predicted 546
14 SASI_Mm01_00169604 predicted 453
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181749
GPR142 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 142
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000027579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181749.1-681s1c1
Sequence:CCGGCGTCTACTTCATTCCCTGCAACTCGAGTTGCAGGGAATGAAGTAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181749.1-40s1c1
Sequence:CCGGGCCTACCAACATGCTGATCTTCTCGAGAAGATCAGCATGTTGGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181749.1-120s1c1
Sequence:CCGGGCCTACAGTCAATGGTAGTAACTCGAGTTACTACCATTGACTGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181749.1-943s1c1
Sequence:CCGGGAGGTCAACTTTGGCCTCTATCTCGAGATAGAGGCCAAAGTTGACCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181749
GPR142 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 142
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000027579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181749.1-681s1c1
Sequence:CCGGCGTCTACTTCATTCCCTGCAACTCGAGTTGCAGGGAATGAAGTAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181749.1-40s1c1
Sequence:CCGGGCCTACCAACATGCTGATCTTCTCGAGAAGATCAGCATGTTGGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181749.1-120s1c1
Sequence:CCGGGCCTACAGTCAATGGTAGTAACTCGAGTTACTACCATTGACTGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181749.1-943s1c1
Sequence:CCGGGAGGTCAACTTTGGCCTCTATCTCGAGATAGAGGCCAAAGTTGACCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181749
GPR142 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 142
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000027579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181749.1-681s1c1
Sequence:CCGGCGTCTACTTCATTCCCTGCAACTCGAGTTGCAGGGAATGAAGTAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181749.1-40s1c1
Sequence:CCGGGCCTACCAACATGCTGATCTTCTCGAGAAGATCAGCATGTTGGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181749.1-120s1c1
Sequence:CCGGGCCTACAGTCAATGGTAGTAACTCGAGTTACTACCATTGACTGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181749.1-943s1c1
Sequence:CCGGGAGGTCAACTTTGGCCTCTATCTCGAGATAGAGGCCAAAGTTGACCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181790
GPR142 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 142
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181790.1-88s1c1
Sequence:CCGGGCATATACTGAGGAAGACAAACTCGAGTTTGTCTTCCTCAGTATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181790.1-946s1c1
Sequence:CCGGGCTCACTGTCTCACTGTCTATCTCGAGATAGACAGTGAGACAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181790.1-201s1c1
Sequence:CCGGCCTCCGAATAAGGCCATCCAACTCGAGTTGGATGGCCTTATTCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181790.1-240s1c1
Sequence:CCGGCCAGGCTCAGTGTCTGCGTAACTCGAGTTACGCAGACACTGAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181790.1-1116s1c1
Sequence:CCGGCCGGGTCTTCGTCATGCTCTACTCGAGTAGAGCATGACGAAGACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181790.1-948s21c1
Sequence:CCGGTCACTGTCTCACTGTCTATTTCTCGAGAAATAGACAGTGAGACAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181790.1-75s21c1
Sequence:CCGGCCTGGGTACAGAAGCATATACCTCGAGGTATATGCTTCTGTACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181790.1-191s21c1
Sequence:CCGGGAAGCTGGGACCTCCGAATAACTCGAGTTATTCGGAGGTCCCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181790.1-1124s21c1
Sequence:CCGGTCGTCATGCTCTACCACATGTCTCGAGACATGTGGTAGAGCATGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181790
GPR142 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 142
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181790.1-88s1c1
Sequence:CCGGGCATATACTGAGGAAGACAAACTCGAGTTTGTCTTCCTCAGTATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181790.1-946s1c1
Sequence:CCGGGCTCACTGTCTCACTGTCTATCTCGAGATAGACAGTGAGACAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181790.1-201s1c1
Sequence:CCGGCCTCCGAATAAGGCCATCCAACTCGAGTTGGATGGCCTTATTCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181790.1-240s1c1
Sequence:CCGGCCAGGCTCAGTGTCTGCGTAACTCGAGTTACGCAGACACTGAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181790.1-1116s1c1
Sequence:CCGGCCGGGTCTTCGTCATGCTCTACTCGAGTAGAGCATGACGAAGACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181790.1-948s21c1
Sequence:CCGGTCACTGTCTCACTGTCTATTTCTCGAGAAATAGACAGTGAGACAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181790.1-75s21c1
Sequence:CCGGCCTGGGTACAGAAGCATATACCTCGAGGTATATGCTTCTGTACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181790.1-191s21c1
Sequence:CCGGGAAGCTGGGACCTCCGAATAACTCGAGTTATTCGGAGGTCCCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181790.1-1124s21c1
Sequence:CCGGTCGTCATGCTCTACCACATGTCTCGAGACATGTGGTAGAGCATGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181790
GPR142 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 142
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181790.1-88s1c1
Sequence:CCGGGCATATACTGAGGAAGACAAACTCGAGTTTGTCTTCCTCAGTATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181790.1-946s1c1
Sequence:CCGGGCTCACTGTCTCACTGTCTATCTCGAGATAGACAGTGAGACAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181790.1-201s1c1
Sequence:CCGGCCTCCGAATAAGGCCATCCAACTCGAGTTGGATGGCCTTATTCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181790.1-240s1c1
Sequence:CCGGCCAGGCTCAGTGTCTGCGTAACTCGAGTTACGCAGACACTGAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181790.1-1116s1c1
Sequence:CCGGCCGGGTCTTCGTCATGCTCTACTCGAGTAGAGCATGACGAAGACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181790.1-948s21c1
Sequence:CCGGTCACTGTCTCACTGTCTATTTCTCGAGAAATAGACAGTGAGACAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181790.1-75s21c1
Sequence:CCGGCCTGGGTACAGAAGCATATACCTCGAGGTATATGCTTCTGTACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181790.1-191s21c1
Sequence:CCGGGAAGCTGGGACCTCCGAATAACTCGAGTTATTCGGAGGTCCCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181790.1-1124s21c1
Sequence:CCGGTCGTCATGCTCTACCACATGTCTCGAGACATGTGGTAGAGCATGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks