EMAIL THIS PAGE TO A FRIEND

GPR143

G protein-coupled receptor 143

51 Gene Product Result for
Synonyms: NYS6 OA1
UniProtKB ID: P51810, Q6NTI7
Gene ID:
Human(4935) Summary: This gene encodes a protein that binds to heterotrimeric G proteins and is targeted to melanosomes in pigment cells. This protein is thought to be involved in intracellular signal transduction mechanisms. Mutations in this gene cause ocular albinism type 1, also referred to as Nettleship-Falls type ocular albinism, a severe visual disorder. A related pseudogene has been identified on chromosome Y. [provided by RefSeq, Dec 2009]
Mouse(18241) G protein-coupled receptor 143
Rat(302619) G protein-coupled receptor 143
Zebrafish(393795) G protein-coupled receptor 143
chicken(418652) G protein-coupled receptor 143
cow(613505) G protein-coupled receptor 143
domestic cat(101087044) G protein-coupled receptor 143
dog(491733) G protein-coupled receptor 143
sheep(101119373) G protein-coupled receptor 143
domestic guinea pig(100734957) G protein-coupled receptor 143
naked mole-rat(101722765) G protein-coupled receptor 143
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000273 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000273 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000273 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010951 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010951 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010951 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU132271 MISSION® esiRNA esiRNA human GPR143 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000273 Rosetta Predictions human pricing
NM_001106958 Rosetta Predictions rat pricing
NM_010951 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000273 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061030 predicted 1179
2 SASI_Hs01_00061031 predicted 517
3 SASI_Hs01_00061032 predicted 702
4 SASI_Hs02_00302229 predicted 1101
5 SASI_Hs01_00061034 predicted 1311
6 SASI_Hs01_00061036 predicted 719
7 SASI_Hs01_00061037 predicted 922
8 SASI_Hs01_00061038 predicted 1211
9 SASI_Hs01_00061039 predicted 912
10 SASI_Hs02_00302230 predicted 996
11 SASI_Hs01_00061033 predicted 886
12 SASI_Hs01_00061035 predicted 1027
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106958 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224086 predicted 1152
2 SASI_Rn02_00224087 predicted 829
3 SASI_Rn02_00224088 predicted 383
4 SASI_Rn02_00224089 predicted 660
5 SASI_Rn02_00224090 predicted 951
6 SASI_Rn02_00224091 predicted 694
7 SASI_Rn02_00224092 predicted 722
8 SASI_Rn02_00224093 predicted 810
9 SASI_Rn02_00224094 predicted 857
10 SASI_Rn02_00224095 predicted 1375
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010951 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173746 predicted 1409
2 SASI_Mm01_00173745 predicted 764
3 SASI_Mm01_00173747 predicted 996
4 SASI_Mm01_00173748 predicted 883
5 SASI_Mm02_00319708 predicted 916
6 SASI_Mm01_00173749 predicted 440
7 SASI_Mm01_00173751 predicted 872
8 SASI_Mm01_00173752 predicted 834
9 SASI_Mm01_00173753 predicted 1010
10 SASI_Mm01_00173754 predicted 1251
11 SASI_Mm01_00173750 predicted 1028
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000273
VALIDATED
GPR143 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 143
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000273.2-555s21c1
Sequence:CCGGGCTATGCAGTGGATGCTTATCCTCGAGGATAAGCATCCACTGCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000273.2-910s21c1
Sequence:CCGGTATTTGTTGGTTGTCGAATATCTCGAGATATTCGACAACCAACAAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000273.2-829s21c1
Sequence:CCGGACAAGGCATTTACACGGAGAACTCGAGTTCTCCGTGTAAATGCCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000273.2-971s21c1
Sequence:CCGGGATATCAATGGAGGTTCTTTGCTCGAGCAAAGAACCTCCATTGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_000273.1-778s1c1
Sequence:CCGGGCCGTGATCAAGATCCGATTTCTCGAGAAATCGGATCTTGATCACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011779    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000273.1-1313s1c1
Sequence:CCGGGACTCAACAATTCTTGTTCTTCTCGAGAAGAACAAGAATTGTTGAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_000273.1-330s1c1
Sequence:CCGGCGTGTGGTTAGGATTCCCAAACTCGAGTTTGGGAATCCTAACCACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000273.1-368s1c1
Sequence:CCGGCGGATATGAACCACACGGAAACTCGAGTTTCCGTGTGGTTCATATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_000273.1-929s1c1
Sequence:CCGGCCACATGGTTTATTATGGGAACTCGAGTTCCCATAATAAACCATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000273
VALIDATED
GPR143 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 143
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000273.2-555s21c1
Sequence:CCGGGCTATGCAGTGGATGCTTATCCTCGAGGATAAGCATCCACTGCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000273.2-910s21c1
Sequence:CCGGTATTTGTTGGTTGTCGAATATCTCGAGATATTCGACAACCAACAAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000273.2-829s21c1
Sequence:CCGGACAAGGCATTTACACGGAGAACTCGAGTTCTCCGTGTAAATGCCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000273.2-971s21c1
Sequence:CCGGGATATCAATGGAGGTTCTTTGCTCGAGCAAAGAACCTCCATTGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_000273.1-778s1c1
Sequence:CCGGGCCGTGATCAAGATCCGATTTCTCGAGAAATCGGATCTTGATCACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011779    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000273.1-1313s1c1
Sequence:CCGGGACTCAACAATTCTTGTTCTTCTCGAGAAGAACAAGAATTGTTGAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_000273.1-330s1c1
Sequence:CCGGCGTGTGGTTAGGATTCCCAAACTCGAGTTTGGGAATCCTAACCACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000273.1-368s1c1
Sequence:CCGGCGGATATGAACCACACGGAAACTCGAGTTTCCGTGTGGTTCATATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_000273.1-929s1c1
Sequence:CCGGCCACATGGTTTATTATGGGAACTCGAGTTCCCATAATAAACCATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000273
VALIDATED
GPR143 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 143
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000273.2-555s21c1
Sequence:CCGGGCTATGCAGTGGATGCTTATCCTCGAGGATAAGCATCCACTGCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000273.2-910s21c1
Sequence:CCGGTATTTGTTGGTTGTCGAATATCTCGAGATATTCGACAACCAACAAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000273.2-829s21c1
Sequence:CCGGACAAGGCATTTACACGGAGAACTCGAGTTCTCCGTGTAAATGCCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000273.2-971s21c1
Sequence:CCGGGATATCAATGGAGGTTCTTTGCTCGAGCAAAGAACCTCCATTGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_000273.1-778s1c1
Sequence:CCGGGCCGTGATCAAGATCCGATTTCTCGAGAAATCGGATCTTGATCACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011779    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000273.1-1313s1c1
Sequence:CCGGGACTCAACAATTCTTGTTCTTCTCGAGAAGAACAAGAATTGTTGAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_000273.1-330s1c1
Sequence:CCGGCGTGTGGTTAGGATTCCCAAACTCGAGTTTGGGAATCCTAACCACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000273.1-368s1c1
Sequence:CCGGCGGATATGAACCACACGGAAACTCGAGTTTCCGTGTGGTTCATATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_000273.1-929s1c1
Sequence:CCGGCCACATGGTTTATTATGGGAACTCGAGTTCCCATAATAAACCATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010951
VALIDATED
GPR143 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 143
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010951.2-636s1c1
Sequence:CCGGCCATTATGTCACCACATACTTCTCGAGAAGTATGTGGTGACATAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010951.2-1190s1c1
Sequence:CCGGCCAGTACTGTTGAAATCCATACTCGAGTATGGATTTCAACAGTACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010951.2-718s1c1
Sequence:CCGGGCCTCTTTACTGAAAGGAAGACTCGAGTCTTCCTTTCAGTAAAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010951.2-1028s1c1
Sequence:CCGGAGATGGTGATTCAGTGGGAAACTCGAGTTTCCCACTGAATCACCATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010951.2-864s1c1
Sequence:CCGGCCTTGAAATGCAACCAGATATCTCGAGATATCTGGTTGCATTTCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010951
VALIDATED
GPR143 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 143
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010951.2-636s1c1
Sequence:CCGGCCATTATGTCACCACATACTTCTCGAGAAGTATGTGGTGACATAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010951.2-1190s1c1
Sequence:CCGGCCAGTACTGTTGAAATCCATACTCGAGTATGGATTTCAACAGTACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010951.2-718s1c1
Sequence:CCGGGCCTCTTTACTGAAAGGAAGACTCGAGTCTTCCTTTCAGTAAAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010951.2-1028s1c1
Sequence:CCGGAGATGGTGATTCAGTGGGAAACTCGAGTTTCCCACTGAATCACCATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010951.2-864s1c1
Sequence:CCGGCCTTGAAATGCAACCAGATATCTCGAGATATCTGGTTGCATTTCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010951
VALIDATED
GPR143 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 143
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010951.2-636s1c1
Sequence:CCGGCCATTATGTCACCACATACTTCTCGAGAAGTATGTGGTGACATAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010951.2-1190s1c1
Sequence:CCGGCCAGTACTGTTGAAATCCATACTCGAGTATGGATTTCAACAGTACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010951.2-718s1c1
Sequence:CCGGGCCTCTTTACTGAAAGGAAGACTCGAGTCTTCCTTTCAGTAAAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010951.2-1028s1c1
Sequence:CCGGAGATGGTGATTCAGTGGGAAACTCGAGTTTCCCACTGAATCACCATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010951.2-864s1c1
Sequence:CCGGCCTTGAAATGCAACCAGATATCTCGAGATATCTGGTTGCATTTCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks