EMAIL THIS PAGE TO A FRIEND

GPR144

G protein-coupled receptor 144

133 Gene Product Result for
Synonyms: PGR24
UniProtKB ID: Q7Z7M1, Q86SL4, Q8NH12
Gene ID:
Mouse(674251) G protein-coupled receptor 144
Zebrafish(571770) G protein-coupled receptor 144
cow(517106) G protein-coupled receptor 144
domestic cat(101088889) G protein-coupled receptor 144
dog(491338) G protein-coupled receptor 144
chicken(100858563) G protein-coupled receptor 144
domestic guinea pig(100729914) G protein-coupled receptor 144
naked mole-rat(101708652) G protein-coupled receptor 144
sheep(101113403) G protein-coupled receptor 144
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182611 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182611 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182611 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001161808 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001161808 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001161808 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182611 Rosetta Predictions human pricing
XR_042072 Rosetta Predictions human pricing
XR_042073 Rosetta Predictions human pricing
XR_042074 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182611 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235546 predicted 1914
2 SASI_Hs01_00235547 predicted 2158
3 SASI_Hs01_00235548 predicted 1128
4 SASI_Hs01_00235549 predicted 1740
5 SASI_Hs01_00235550 predicted 2178
6 SASI_Hs01_00235551 predicted 2549
7 SASI_Hs01_00235552 predicted 2463
8 SASI_Hs01_00235553 predicted 1583
9 SASI_Hs01_00235554 predicted 1379
10 SASI_Hs01_00235555 predicted 946
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_042072 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00532857 predicted 1947
2 SASI_Hs02_00532858 predicted 196
3 SASI_Hs02_00532859 predicted 2180
4 SASI_Hs02_00532860 predicted 1150
5 SASI_Hs02_00532861 predicted 976
6 SASI_Hs02_00532862 predicted 1999
7 SASI_Hs02_00532863 predicted 1763
8 SASI_Hs02_00532864 predicted 2199
9 SASI_Hs02_00532865 predicted 2576
10 SASI_Hs02_00532866 predicted 2490
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_042073 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00532867 predicted 2737
2 SASI_Hs02_00532868 predicted 525
3 SASI_Hs02_00532869 predicted 1236
4 SASI_Hs02_00532870 predicted 2191
5 SASI_Hs02_00532871 predicted 3613
6 SASI_Hs02_00532872 predicted 459
7 SASI_Hs02_00532873 predicted 812
8 SASI_Hs02_00532874 predicted 3126
9 SASI_Hs02_00532875 predicted 660
10 SASI_Hs02_00532876 predicted 3249
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_042074 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00532877 predicted 2734
2 SASI_Hs02_00532878 predicted 525
3 SASI_Hs02_00532879 predicted 1233
4 SASI_Hs02_00532880 predicted 2187
5 SASI_Hs02_00532881 predicted 3617
6 SASI_Hs02_00532882 predicted 458
7 SASI_Hs02_00532883 predicted 811
8 SASI_Hs02_00532884 predicted 3120
9 SASI_Hs02_00532885 predicted 656
10 SASI_Hs02_00532886 predicted 3241
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182611
GPR144 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 144
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182611.1-1123s1c1
Sequence:CCGGGATGTTATCAGCCGAGTCAATCTCGAGATTGACTCGGCTGATAACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182611.1-2683s1c1
Sequence:CCGGCTGTACATCTTCCTGGTTTATCTCGAGATAAACCAGGAAGATGTACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182611.1-91s1c1
Sequence:CCGGCAGGTGAATCAAGGAACCCTTCTCGAGAAGGGTTCCTTGATTCACCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182611.1-2368s1c1
Sequence:CCGGCCCGGACATTGCTGGCTCAATCTCGAGATTGAGCCAGCAATGTCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182611.1-1918s1c1
Sequence:CCGGGCCATCCTGCTGCAAATCTATCTCGAGATAGATTTGCAGCAGGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182611
GPR144 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 144
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182611.1-1123s1c1
Sequence:CCGGGATGTTATCAGCCGAGTCAATCTCGAGATTGACTCGGCTGATAACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182611.1-2683s1c1
Sequence:CCGGCTGTACATCTTCCTGGTTTATCTCGAGATAAACCAGGAAGATGTACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182611.1-91s1c1
Sequence:CCGGCAGGTGAATCAAGGAACCCTTCTCGAGAAGGGTTCCTTGATTCACCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182611.1-2368s1c1
Sequence:CCGGCCCGGACATTGCTGGCTCAATCTCGAGATTGAGCCAGCAATGTCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182611.1-1918s1c1
Sequence:CCGGGCCATCCTGCTGCAAATCTATCTCGAGATAGATTTGCAGCAGGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182611
GPR144 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 144
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182611.1-1123s1c1
Sequence:CCGGGATGTTATCAGCCGAGTCAATCTCGAGATTGACTCGGCTGATAACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182611.1-2683s1c1
Sequence:CCGGCTGTACATCTTCCTGGTTTATCTCGAGATAAACCAGGAAGATGTACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182611.1-91s1c1
Sequence:CCGGCAGGTGAATCAAGGAACCCTTCTCGAGAAGGGTTCCTTGATTCACCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182611.1-2368s1c1
Sequence:CCGGCCCGGACATTGCTGGCTCAATCTCGAGATTGAGCCAGCAATGTCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182611.1-1918s1c1
Sequence:CCGGGCCATCCTGCTGCAAATCTATCTCGAGATAGATTTGCAGCAGGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001161808
GPR144 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 144
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000358416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161808.1-1919s21c1
Sequence:CCGGCCATCCTGCTGCAAATCTATGCTCGAGCATAGATTTGCAGCAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161808.1-2684s21c1
Sequence:CCGGTGTACATCTTCCTGGTTTATGCTCGAGCATAAACCAGGAAGATGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161808.1-1970s21c1
Sequence:CCGGTGCTGAGGACTCTGTCATTTGCTCGAGCAAATGACAGAGTCCTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161808.1-1124s21c1
Sequence:CCGGATGTTATCAGCCGAGTCAATGCTCGAGCATTGACTCGGCTGATAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001161808
GPR144 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 144
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000358416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161808.1-1919s21c1
Sequence:CCGGCCATCCTGCTGCAAATCTATGCTCGAGCATAGATTTGCAGCAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161808.1-2684s21c1
Sequence:CCGGTGTACATCTTCCTGGTTTATGCTCGAGCATAAACCAGGAAGATGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161808.1-1970s21c1
Sequence:CCGGTGCTGAGGACTCTGTCATTTGCTCGAGCAAATGACAGAGTCCTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161808.1-1124s21c1
Sequence:CCGGATGTTATCAGCCGAGTCAATGCTCGAGCATTGACTCGGCTGATAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001161808
GPR144 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 144
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000358416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161808.1-1919s21c1
Sequence:CCGGCCATCCTGCTGCAAATCTATGCTCGAGCATAGATTTGCAGCAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161808.1-2684s21c1
Sequence:CCGGTGTACATCTTCCTGGTTTATGCTCGAGCATAAACCAGGAAGATGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161808.1-1970s21c1
Sequence:CCGGTGCTGAGGACTCTGTCATTTGCTCGAGCAAATGACAGAGTCCTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161808.1-1124s21c1
Sequence:CCGGATGTTATCAGCCGAGTCAATGCTCGAGCATTGACTCGGCTGATAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks