EMAIL THIS PAGE TO A FRIEND

GPR146

G protein-coupled receptor 146

60 Gene Product Result for
Synonyms: PGR8
UniProtKB ID: Q96CH1, Q86SP5
Gene ID:
Mouse(80290) G protein-coupled receptor 146
Rat(498153) G protein-coupled receptor 146
sheep(101114925) G protein-coupled receptor 146
domestic guinea pig(100713286) G protein-coupled receptor 146
naked mole-rat(101703196) G protein-coupled receptor 146
Zebrafish(565192) G protein-coupled receptor 146
domestic cat(101085515) G protein-coupled receptor 146
cow(506876) G protein-coupled receptor 146
dog(491603) G protein-coupled receptor 146
chicken(416456) G protein-coupled receptor 146
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138445 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138445 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138445 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030258 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030258 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030258 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU029941 MISSION® esiRNA esiRNA human GPR146 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138445 Rosetta Predictions human pricing
NM_001109062 Rosetta Predictions rat pricing
NM_001038703 Rosetta Predictions mouse pricing
NM_030258 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138445 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147432 predicted 410
2 SASI_Hs01_00147434 predicted 776
3 SASI_Hs01_00147435 predicted 1321
4 SASI_Hs01_00147436 predicted 615
5 SASI_Hs01_00147437 predicted 481
6 SASI_Hs01_00147439 predicted 1320
7 SASI_Hs01_00147440 predicted 373
8 SASI_Hs01_00147441 predicted 1032
9 SASI_Hs02_00363609 predicted 1288
10 SASI_Hs02_00363610 predicted 441
11 SASI_Hs01_00147433 predicted 758
12 SASI_Hs01_00147438 predicted 871
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109062 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244750 predicted 1463
2 SASI_Rn02_00244751 predicted 939
3 SASI_Rn02_00244752 predicted 616
4 SASI_Rn02_00244753 predicted 1506
5 SASI_Rn02_00244754 predicted 1533
6 SASI_Rn02_00244755 predicted 524
7 SASI_Rn02_00244756 predicted 520
8 SASI_Rn02_00244757 predicted 1344
9 SASI_Rn02_00244758 predicted 304
10 SASI_Rn02_00244759 predicted 1467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038703 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142488 predicted 1563
2 SASI_Mm02_00289694 predicted 694
3 SASI_Mm01_00142489 predicted 734
4 SASI_Mm01_00142490 predicted 1565
5 SASI_Mm01_00142491 predicted 570
6 SASI_Mm01_00142492 predicted 1480
7 SASI_Mm01_00142494 predicted 500
8 SASI_Mm01_00142495 predicted 1272
9 SASI_Mm01_00142496 predicted 477
10 SASI_Mm01_00142497 predicted 1149
11 SASI_Mm01_00142493 predicted 1049
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030258 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021894 predicted 1489
2 SASI_Mm02_00336730 predicted 623
3 SASI_Mm01_00021895 predicted 657
4 SASI_Mm01_00021896 predicted 1488
5 SASI_Mm01_00021897 predicted 500
6 SASI_Mm01_00021898 predicted 1405
7 SASI_Mm01_00021900 predicted 434
8 SASI_Mm01_00021901 predicted 1200
9 SASI_Mm01_00021902 predicted 401
10 SASI_Mm01_00021903 predicted 1080
11 SASI_Mm01_00021899 predicted 973
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138445
VALIDATED
GPR146 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 146
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138445.2-419s21c1
Sequence:CCGGCTACATGGCCAGCGTGTACAACTCGAGTTGTACACGCTGGCCATGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138445.2-547s21c1
Sequence:CCGGCCAAGATGCAGAACGCAGAAGCTCGAGCTTCTGCGTTCTGCATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138445.2-1320s21c1
Sequence:CCGGGAAAGCTTAGAGCCAGTATTTCTCGAGAAATACTGGCTCTAAGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138445.2-746s21c1
Sequence:CCGGCTGGACGCCACACTATCTGATCTCGAGATCAGATAGTGTGGCGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138445.2-1049s21c1
Sequence:CCGGGGACGCAGAGCACTTAGTTACCTCGAGGTAACTAAGTGCTCTGCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138445.2-888s21c1
Sequence:CCGGCCACTTCTCTACCGCTACATGCTCGAGCATGTAGCGGTAGAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138445.2-832s21c1
Sequence:CCGGTGCACTTTGTGAAGGATTTCTCTCGAGAGAAATCCTTCACAAAGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138445.2-189s21c1
Sequence:CCGGACCATGCCGGACGTGTACTTTCTCGAGAAAGTACACGTCCGGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_138445.2-492s21c1
Sequence:CCGGTCCTCGCTGCTCTTCTACATCCTCGAGGATGTAGAAGAGCAGCGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138445.2-899s1c1
Sequence:CCGGCCGCTACATGAACCAGAGCTTCTCGAGAAGCTCTGGTTCATGTAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138445.2-533s1c1
Sequence:CCGGCGCGCTAGAGTGCGCCAAGATCTCGAGATCTTGGCGCACTCTAGCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138445.2-887s1c1
Sequence:CCGGACCACTTCTCTACCGCTACATCTCGAGATGTAGCGGTAGAGAAGTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_138445.2-196s1c1
Sequence:CCGGCGGACGTGTACTTTGTCAACACTCGAGTGTTGACAAAGTACACGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011712    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138445.2-1573s1c1
Sequence:CCGGGCTGGTGTTAAATGGAGCTATCTCGAGATAGCTCCATTTAACACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138445
VALIDATED
GPR146 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 146
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138445.2-419s21c1
Sequence:CCGGCTACATGGCCAGCGTGTACAACTCGAGTTGTACACGCTGGCCATGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138445.2-547s21c1
Sequence:CCGGCCAAGATGCAGAACGCAGAAGCTCGAGCTTCTGCGTTCTGCATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138445.2-1320s21c1
Sequence:CCGGGAAAGCTTAGAGCCAGTATTTCTCGAGAAATACTGGCTCTAAGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138445.2-746s21c1
Sequence:CCGGCTGGACGCCACACTATCTGATCTCGAGATCAGATAGTGTGGCGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138445.2-1049s21c1
Sequence:CCGGGGACGCAGAGCACTTAGTTACCTCGAGGTAACTAAGTGCTCTGCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138445.2-888s21c1
Sequence:CCGGCCACTTCTCTACCGCTACATGCTCGAGCATGTAGCGGTAGAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138445.2-832s21c1
Sequence:CCGGTGCACTTTGTGAAGGATTTCTCTCGAGAGAAATCCTTCACAAAGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138445.2-189s21c1
Sequence:CCGGACCATGCCGGACGTGTACTTTCTCGAGAAAGTACACGTCCGGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_138445.2-492s21c1
Sequence:CCGGTCCTCGCTGCTCTTCTACATCCTCGAGGATGTAGAAGAGCAGCGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138445.2-899s1c1
Sequence:CCGGCCGCTACATGAACCAGAGCTTCTCGAGAAGCTCTGGTTCATGTAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138445.2-533s1c1
Sequence:CCGGCGCGCTAGAGTGCGCCAAGATCTCGAGATCTTGGCGCACTCTAGCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138445.2-887s1c1
Sequence:CCGGACCACTTCTCTACCGCTACATCTCGAGATGTAGCGGTAGAGAAGTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_138445.2-196s1c1
Sequence:CCGGCGGACGTGTACTTTGTCAACACTCGAGTGTTGACAAAGTACACGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011712    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138445.2-1573s1c1
Sequence:CCGGGCTGGTGTTAAATGGAGCTATCTCGAGATAGCTCCATTTAACACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138445
VALIDATED
GPR146 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 146
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138445.2-419s21c1
Sequence:CCGGCTACATGGCCAGCGTGTACAACTCGAGTTGTACACGCTGGCCATGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138445.2-547s21c1
Sequence:CCGGCCAAGATGCAGAACGCAGAAGCTCGAGCTTCTGCGTTCTGCATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138445.2-1320s21c1
Sequence:CCGGGAAAGCTTAGAGCCAGTATTTCTCGAGAAATACTGGCTCTAAGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138445.2-746s21c1
Sequence:CCGGCTGGACGCCACACTATCTGATCTCGAGATCAGATAGTGTGGCGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138445.2-1049s21c1
Sequence:CCGGGGACGCAGAGCACTTAGTTACCTCGAGGTAACTAAGTGCTCTGCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138445.2-888s21c1
Sequence:CCGGCCACTTCTCTACCGCTACATGCTCGAGCATGTAGCGGTAGAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138445.2-832s21c1
Sequence:CCGGTGCACTTTGTGAAGGATTTCTCTCGAGAGAAATCCTTCACAAAGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138445.2-189s21c1
Sequence:CCGGACCATGCCGGACGTGTACTTTCTCGAGAAAGTACACGTCCGGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_138445.2-492s21c1
Sequence:CCGGTCCTCGCTGCTCTTCTACATCCTCGAGGATGTAGAAGAGCAGCGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138445.2-899s1c1
Sequence:CCGGCCGCTACATGAACCAGAGCTTCTCGAGAAGCTCTGGTTCATGTAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138445.2-533s1c1
Sequence:CCGGCGCGCTAGAGTGCGCCAAGATCTCGAGATCTTGGCGCACTCTAGCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138445.2-887s1c1
Sequence:CCGGACCACTTCTCTACCGCTACATCTCGAGATGTAGCGGTAGAGAAGTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_138445.2-196s1c1
Sequence:CCGGCGGACGTGTACTTTGTCAACACTCGAGTGTTGACAAAGTACACGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011712    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138445.2-1573s1c1
Sequence:CCGGGCTGGTGTTAAATGGAGCTATCTCGAGATAGCTCCATTTAACACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030258
GPR146 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 146
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030258.2-1444s1c1
Sequence:CCGGCCCTGGTATTTGGGCTTTCTACTCGAGTAGAAAGCCCAAATACCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030258.2-999s1c1
Sequence:CCGGGCTCTACCGTTACATCAACAACTCGAGTTGTTGATGTAACGGTAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030258.2-306s1c1
Sequence:CCGGCGACGTGTACTTCGTGAACATCTCGAGATGTTCACGAAGTACACGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030258.2-235s1c1
Sequence:CCGGCCTGTGAGCTTAGGCTATAATCTCGAGATTATAGCCTAAGCTCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030258.2-852s1c1
Sequence:CCGGCCTCTGGACACCTTACTACTTCTCGAGAAGTAGTAAGGTGTCCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030258
GPR146 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 146
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030258.2-1444s1c1
Sequence:CCGGCCCTGGTATTTGGGCTTTCTACTCGAGTAGAAAGCCCAAATACCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030258.2-999s1c1
Sequence:CCGGGCTCTACCGTTACATCAACAACTCGAGTTGTTGATGTAACGGTAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030258.2-306s1c1
Sequence:CCGGCGACGTGTACTTCGTGAACATCTCGAGATGTTCACGAAGTACACGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030258.2-235s1c1
Sequence:CCGGCCTGTGAGCTTAGGCTATAATCTCGAGATTATAGCCTAAGCTCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030258.2-852s1c1
Sequence:CCGGCCTCTGGACACCTTACTACTTCTCGAGAAGTAGTAAGGTGTCCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030258
GPR146 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 146
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030258.2-1444s1c1
Sequence:CCGGCCCTGGTATTTGGGCTTTCTACTCGAGTAGAAAGCCCAAATACCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030258.2-999s1c1
Sequence:CCGGGCTCTACCGTTACATCAACAACTCGAGTTGTTGATGTAACGGTAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030258.2-306s1c1
Sequence:CCGGCGACGTGTACTTCGTGAACATCTCGAGATGTTCACGAAGTACACGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030258.2-235s1c1
Sequence:CCGGCCTGTGAGCTTAGGCTATAATCTCGAGATTATAGCCTAAGCTCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030258.2-852s1c1
Sequence:CCGGCCTCTGGACACCTTACTACTTCTCGAGAAGTAGTAAGGTGTCCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks