EMAIL THIS PAGE TO A FRIEND

GPR148

G protein-coupled receptor 148

21 Gene Product Result for
Synonyms: BTR PGR6
Species: Human GPR148(344561), domestic cat GPR148(101094439), domestic guinea pig Gpr148(100728657)
UniProtKB ID: Q8TDV2, Q2M369, Q86SP7, Q86U87
Gene ID:
domestic cat(101094439) G protein-coupled receptor 148
domestic guinea pig(100728657) G protein-coupled receptor 148
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207364 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207364 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207364 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207364 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207364 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373947 predicted 906
2 SASI_Hs01_00202667 predicted 278
3 SASI_Hs01_00202668 predicted 422
4 SASI_Hs01_00202669 predicted 716
5 SASI_Hs01_00202670 predicted 852
6 SASI_Hs02_00373948 predicted 854
7 SASI_Hs01_00202671 predicted 585
8 SASI_Hs01_00202673 predicted 421
9 SASI_Hs01_00202674 predicted 701
10 SASI_Hs01_00202675 predicted 276
11 SASI_Hs01_00202672 predicted 700
12 SASI_Hs01_00202676 predicted 711
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207364
GPR148 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 148
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207364.1-697s1c1
Sequence:CCGGCAGCTCTCATTGCCAACTGTTCTCGAGAACAGTTGGCAATGAGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207364.1-1020s1c1
Sequence:CCGGCACCAGGCCATCTTTACCATTCTCGAGAATGGTAAAGATGGCCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207364.1-360s1c1
Sequence:CCGGGCCTGTGGCATTCTCACTGATCTCGAGATCAGTGAGAATGCCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207364.1-541s1c1
Sequence:CCGGCCACATTCCTTATTTGGCTCACTCGAGTGAGCCAAATAAGGAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207364.1-597s1c1
Sequence:CCGGGCTTCATACATCCTACCACCACTCGAGTGGTGGTAGGATGTATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207364.1-688s21c1
Sequence:CCGGTCCTCTGCACAGCTCTCATTGCTCGAGCAATGAGAGCTGTGCAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207364.1-641s21c1
Sequence:CCGGTGGCCTCCTGGTCATTGTTACCTCGAGGTAACAATGACCAGGAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207364.1-585s21c1
Sequence:CCGGGAGGAGCAAGGAGCTTCATACCTCGAGGTATGAAGCTCCTTGCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207364
GPR148 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 148
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207364.1-697s1c1
Sequence:CCGGCAGCTCTCATTGCCAACTGTTCTCGAGAACAGTTGGCAATGAGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207364.1-1020s1c1
Sequence:CCGGCACCAGGCCATCTTTACCATTCTCGAGAATGGTAAAGATGGCCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207364.1-360s1c1
Sequence:CCGGGCCTGTGGCATTCTCACTGATCTCGAGATCAGTGAGAATGCCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207364.1-541s1c1
Sequence:CCGGCCACATTCCTTATTTGGCTCACTCGAGTGAGCCAAATAAGGAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207364.1-597s1c1
Sequence:CCGGGCTTCATACATCCTACCACCACTCGAGTGGTGGTAGGATGTATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207364.1-688s21c1
Sequence:CCGGTCCTCTGCACAGCTCTCATTGCTCGAGCAATGAGAGCTGTGCAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207364.1-641s21c1
Sequence:CCGGTGGCCTCCTGGTCATTGTTACCTCGAGGTAACAATGACCAGGAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207364.1-585s21c1
Sequence:CCGGGAGGAGCAAGGAGCTTCATACCTCGAGGTATGAAGCTCCTTGCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207364
GPR148 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 148
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207364.1-697s1c1
Sequence:CCGGCAGCTCTCATTGCCAACTGTTCTCGAGAACAGTTGGCAATGAGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207364.1-1020s1c1
Sequence:CCGGCACCAGGCCATCTTTACCATTCTCGAGAATGGTAAAGATGGCCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207364.1-360s1c1
Sequence:CCGGGCCTGTGGCATTCTCACTGATCTCGAGATCAGTGAGAATGCCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207364.1-541s1c1
Sequence:CCGGCCACATTCCTTATTTGGCTCACTCGAGTGAGCCAAATAAGGAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207364.1-597s1c1
Sequence:CCGGGCTTCATACATCCTACCACCACTCGAGTGGTGGTAGGATGTATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207364.1-688s21c1
Sequence:CCGGTCCTCTGCACAGCTCTCATTGCTCGAGCAATGAGAGCTGTGCAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207364.1-641s21c1
Sequence:CCGGTGGCCTCCTGGTCATTGTTACCTCGAGGTAACAATGACCAGGAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207364.1-585s21c1
Sequence:CCGGGAGGAGCAAGGAGCTTCATACCTCGAGGTATGAAGCTCCTTGCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks