EMAIL THIS PAGE TO A FRIEND

GPR149

G protein-coupled receptor 149

54 Gene Product Result for
Synonyms: IEDA PGR10
UniProtKB ID: Q86SP6
Gene ID:
Mouse(229357) G protein-coupled receptor 149
Rat(192251) G protein-coupled receptor 149
domestic guinea pig(100725602) G protein-coupled receptor 149
naked mole-rat(101714407) G protein-coupled receptor 149
sheep(101121311) G protein-coupled receptor 149
Domestic Rabbit(100357244) G protein-coupled receptor 149
chicken(395382) G protein-coupled receptor 149
cow(530069) G protein-coupled receptor 149
domestic cat(101089289) G protein-coupled receptor 149
dog(477119) G protein-coupled receptor 149
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001038705 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001038705 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001038705 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177346 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177346 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177346 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001038705 Rosetta Predictions human pricing
NM_138891 Rosetta Predictions rat pricing
NM_177346 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038705 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308412 predicted 783
2 SASI_Hs01_00133762 predicted 1123
3 SASI_Hs01_00133763 predicted 1423
4 SASI_Hs01_00133764 predicted 1638
5 SASI_Hs01_00133765 predicted 1523
6 SASI_Hs01_00133766 predicted 255
7 SASI_Hs01_00133767 predicted 1721
8 SASI_Hs01_00133768 predicted 1993
9 SASI_Hs02_00308413 predicted 1804
10 SASI_Hs01_00133769 predicted 1507
11 SASI_Hs01_00133760 predicted 1511
12 SASI_Hs01_00133761 predicted 1897
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138891 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115436 predicted 572
2 SASI_Rn02_00268335 predicted 1954
3 SASI_Rn01_00115438 predicted 2816
4 SASI_Rn01_00115439 predicted 1739
5 SASI_Rn01_00115440 predicted 2354
6 SASI_Rn01_00115441 predicted 881
7 SASI_Rn01_00115442 predicted 709
8 SASI_Rn02_00268336 predicted 1937
9 SASI_Rn01_00115444 predicted 1761
10 SASI_Rn01_00115445 predicted 587
11 SASI_Rn01_00115437 predicted 571
12 SASI_Rn01_00115443 predicted 1708
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177346 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029850 predicted 994
2 SASI_Mm01_00029851 predicted 1754
3 SASI_Mm01_00029852 predicted 1622
4 SASI_Mm02_00347477 predicted 2802
5 SASI_Mm01_00029853 predicted 1835
6 SASI_Mm01_00029854 predicted 932
7 SASI_Mm01_00029855 predicted 2449
8 SASI_Mm01_00029856 predicted 2837
9 SASI_Mm01_00029857 predicted 2607
10 SASI_Mm02_00347478 predicted 2734
11 SASI_Mm01_00029858 predicted 2811
12 SASI_Mm01_00029859 predicted 1032
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001038705
GPR149 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 149
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000360250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038705.1-794s21c1
Sequence:CCGGATTTCCCGTGGAGCTTCAATTCTCGAGAATTGAAGCTCCACGGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038705.1-144s21c1
Sequence:CCGGTGTGGAAAGAGAATCATAATTCTCGAGAATTATGATTCTCTTTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038705.1-467s21c1
Sequence:CCGGGCGACTCTCCTAGTCTCTTACCTCGAGGTAAGAGACTAGGAGAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038705.1-1683s21c1
Sequence:CCGGGGGAGTGGTGTAGGAGTAAATCTCGAGATTTACTCCTACACCACTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038705.1-180s21c1
Sequence:CCGGATCCGCCAGGAACCCTGAATACTCGAGTATTCAGGGTTCCTGGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038705.1-1335s21c1
Sequence:CCGGTAGCACATGAAGATTACTATGCTCGAGCATAGTAATCTTCATGTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038705.1-658s21c1
Sequence:CCGGCTCCAGCTCCTACGTACTATTCTCGAGAATAGTACGTAGGAGCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038705.1-2136s21c1
Sequence:CCGGGTAATCCTGATGGTGATATTACTCGAGTAATATCACCATCAGGATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001038705
GPR149 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 149
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000360250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038705.1-794s21c1
Sequence:CCGGATTTCCCGTGGAGCTTCAATTCTCGAGAATTGAAGCTCCACGGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038705.1-144s21c1
Sequence:CCGGTGTGGAAAGAGAATCATAATTCTCGAGAATTATGATTCTCTTTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038705.1-467s21c1
Sequence:CCGGGCGACTCTCCTAGTCTCTTACCTCGAGGTAAGAGACTAGGAGAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038705.1-1683s21c1
Sequence:CCGGGGGAGTGGTGTAGGAGTAAATCTCGAGATTTACTCCTACACCACTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038705.1-180s21c1
Sequence:CCGGATCCGCCAGGAACCCTGAATACTCGAGTATTCAGGGTTCCTGGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038705.1-1335s21c1
Sequence:CCGGTAGCACATGAAGATTACTATGCTCGAGCATAGTAATCTTCATGTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038705.1-658s21c1
Sequence:CCGGCTCCAGCTCCTACGTACTATTCTCGAGAATAGTACGTAGGAGCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038705.1-2136s21c1
Sequence:CCGGGTAATCCTGATGGTGATATTACTCGAGTAATATCACCATCAGGATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001038705
GPR149 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 149
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000360250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038705.1-794s21c1
Sequence:CCGGATTTCCCGTGGAGCTTCAATTCTCGAGAATTGAAGCTCCACGGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038705.1-144s21c1
Sequence:CCGGTGTGGAAAGAGAATCATAATTCTCGAGAATTATGATTCTCTTTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038705.1-467s21c1
Sequence:CCGGGCGACTCTCCTAGTCTCTTACCTCGAGGTAAGAGACTAGGAGAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038705.1-1683s21c1
Sequence:CCGGGGGAGTGGTGTAGGAGTAAATCTCGAGATTTACTCCTACACCACTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038705.1-180s21c1
Sequence:CCGGATCCGCCAGGAACCCTGAATACTCGAGTATTCAGGGTTCCTGGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038705.1-1335s21c1
Sequence:CCGGTAGCACATGAAGATTACTATGCTCGAGCATAGTAATCTTCATGTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038705.1-658s21c1
Sequence:CCGGCTCCAGCTCCTACGTACTATTCTCGAGAATAGTACGTAGGAGCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038705.1-2136s21c1
Sequence:CCGGGTAATCCTGATGGTGATATTACTCGAGTAATATCACCATCAGGATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177346
GPR149 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 149
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125009    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177346.1-1565s1c1
Sequence:CCGGCCCACTTTCTTCTAGTTATATCTCGAGATATAACTAGAAGAAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177346.1-578s1c1
Sequence:CCGGCCAAAGAATTATGAGTGTGAACTCGAGTTCACACTCATAATTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177346.1-562s1c1
Sequence:CCGGCATATCCTATCACAACCCAAACTCGAGTTTGGGTTGTGATAGGATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177346.1-783s1c1
Sequence:CCGGGCGATATTAACTATGGAGAAACTCGAGTTTCTCCATAGTTAATATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177346.1-365s1c1
Sequence:CCGGCCAGTGTTTGTCTTATCCAAACTCGAGTTTGGATAAGACAAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177346
GPR149 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 149
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125009    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177346.1-1565s1c1
Sequence:CCGGCCCACTTTCTTCTAGTTATATCTCGAGATATAACTAGAAGAAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177346.1-578s1c1
Sequence:CCGGCCAAAGAATTATGAGTGTGAACTCGAGTTCACACTCATAATTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177346.1-562s1c1
Sequence:CCGGCATATCCTATCACAACCCAAACTCGAGTTTGGGTTGTGATAGGATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177346.1-783s1c1
Sequence:CCGGGCGATATTAACTATGGAGAAACTCGAGTTTCTCCATAGTTAATATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177346.1-365s1c1
Sequence:CCGGCCAGTGTTTGTCTTATCCAAACTCGAGTTTGGATAAGACAAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177346
GPR149 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 149
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125009    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177346.1-1565s1c1
Sequence:CCGGCCCACTTTCTTCTAGTTATATCTCGAGATATAACTAGAAGAAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177346.1-578s1c1
Sequence:CCGGCCAAAGAATTATGAGTGTGAACTCGAGTTCACACTCATAATTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177346.1-562s1c1
Sequence:CCGGCATATCCTATCACAACCCAAACTCGAGTTTGGGTTGTGATAGGATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177346.1-783s1c1
Sequence:CCGGGCGATATTAACTATGGAGAAACTCGAGTTTCTCCATAGTTAATATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177346.1-365s1c1
Sequence:CCGGCCAGTGTTTGTCTTATCCAAACTCGAGTTTGGATAAGACAAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks