EMAIL THIS PAGE TO A FRIEND

GPR150

G protein-coupled receptor 150

58 Gene Product Result for
Synonyms: PGR11
UniProtKB ID: Q8NGU9
Gene ID:
Mouse(238725) G protein-coupled receptor 150
Rat(499486) G protein-coupled receptor 150
domestic guinea pig(100717055) G protein-coupled receptor 150
naked mole-rat(101699067) G protein-coupled receptor 150
domestic cat(101088215) G protein-coupled receptor 150
cow(785100) G protein-coupled receptor 150
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175495 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175495 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175495 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_199243 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199243 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199243 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_199243 Rosetta Predictions human pricing
NM_001109173 Rosetta Predictions rat pricing
XM_574811 Rosetta Predictions rat pricing
NM_175495 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199243 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241951 predicted 1034
2 SASI_Hs01_00241952 predicted 1011
3 SASI_Hs01_00241953 predicted 1030
4 SASI_Hs01_00241954 predicted 1027
5 SASI_Hs01_00241956 predicted 907
6 SASI_Hs01_00241957 predicted 915
7 SASI_Hs01_00241958 predicted 972
8 SASI_Hs01_00241959 predicted 1024
9 SASI_Hs01_00241960 predicted 1038
10 SASI_Hs02_00372679 predicted 1036
11 SASI_Hs01_00241955 predicted 1010
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109173 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245840 predicted 329
2 SASI_Rn02_00245841 predicted 1201
3 SASI_Rn02_00245842 predicted 1197
4 SASI_Rn02_00245843 predicted 897
5 SASI_Rn02_00245844 predicted 803
6 SASI_Rn02_00245845 predicted 1483
7 SASI_Rn02_00245846 predicted 1497
8 SASI_Rn02_00245847 predicted 1207
9 SASI_Rn02_00245848 predicted 520
10 SASI_Rn02_00245849 predicted 862
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574811 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00160519 predicted 708
2 SASI_Rn01_00160520 predicted 790
3 SASI_Rn01_00160521 predicted 1021
4 SASI_Rn01_00160522 predicted 1019
5 SASI_Rn01_00160523 predicted 733
6 SASI_Rn01_00160524 predicted 845
7 SASI_Rn01_00160525 predicted 711
8 SASI_Rn01_00160526 predicted 866
9 SASI_Rn01_00160527 predicted 709
10 SASI_Rn01_00160528 predicted 899
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175495 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162965 predicted 311
2 SASI_Mm01_00162966 predicted 479
3 SASI_Mm01_00162967 predicted 206
4 SASI_Mm01_00162968 predicted 1177
5 SASI_Mm01_00162969 predicted 540
6 SASI_Mm01_00162970 predicted 835
7 SASI_Mm01_00162971 predicted 747
8 SASI_Mm01_00162972 predicted 245
9 SASI_Mm01_00162973 predicted 226
10 SASI_Mm01_00162974 predicted 1438
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175495
GPR150 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 150
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000440599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175495.2-1288s21c1
Sequence:CCGGAGAAGCCGATATCAGCGAATGCTCGAGCATTCGCTGATATCGGCTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175495.2-1186s1c1
Sequence:CCGGCGCCATCAACCCTTTGATCTACTCGAGTAGATCAAAGGGTTGATGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175495.2-1873s1c1
Sequence:CCGGGCTTAAATCAAGTGCATCTTTCTCGAGAAAGATGCACTTGATTTAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175495.2-1016s1c1
Sequence:CCGGGCCAAGGTGCAAAGCTTGAAACTCGAGTTTCAAGCTTTGCACCTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175495.2-206s1c1
Sequence:CCGGCCCGCATCCAACCTTTCTGTACTCGAGTACAGAAAGGTTGGATGCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175495.2-1435s1c1
Sequence:CCGGCTCCTGTGAAAGTGCCTTCTACTCGAGTAGAAGGCACTTTCACAGGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175495
GPR150 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 150
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000440599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175495.2-1288s21c1
Sequence:CCGGAGAAGCCGATATCAGCGAATGCTCGAGCATTCGCTGATATCGGCTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175495.2-1186s1c1
Sequence:CCGGCGCCATCAACCCTTTGATCTACTCGAGTAGATCAAAGGGTTGATGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175495.2-1873s1c1
Sequence:CCGGGCTTAAATCAAGTGCATCTTTCTCGAGAAAGATGCACTTGATTTAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175495.2-1016s1c1
Sequence:CCGGGCCAAGGTGCAAAGCTTGAAACTCGAGTTTCAAGCTTTGCACCTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175495.2-206s1c1
Sequence:CCGGCCCGCATCCAACCTTTCTGTACTCGAGTACAGAAAGGTTGGATGCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175495.2-1435s1c1
Sequence:CCGGCTCCTGTGAAAGTGCCTTCTACTCGAGTAGAAGGCACTTTCACAGGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175495
GPR150 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 150
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000440599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175495.2-1288s21c1
Sequence:CCGGAGAAGCCGATATCAGCGAATGCTCGAGCATTCGCTGATATCGGCTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175495.2-1186s1c1
Sequence:CCGGCGCCATCAACCCTTTGATCTACTCGAGTAGATCAAAGGGTTGATGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175495.2-1873s1c1
Sequence:CCGGGCTTAAATCAAGTGCATCTTTCTCGAGAAAGATGCACTTGATTTAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175495.2-1016s1c1
Sequence:CCGGGCCAAGGTGCAAAGCTTGAAACTCGAGTTTCAAGCTTTGCACCTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175495.2-206s1c1
Sequence:CCGGCCCGCATCCAACCTTTCTGTACTCGAGTACAGAAAGGTTGGATGCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175495.2-1435s1c1
Sequence:CCGGCTCCTGTGAAAGTGCCTTCTACTCGAGTAGAAGGCACTTTCACAGGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199243
GPR150 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 150
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199243.1-685s21c1
Sequence:CCGGCTGCAGGTCTACGCGTTCTACCTCGAGGTAGAACGCGTAGACCTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199243.1-1036s21c1
Sequence:CCGGGCTCTCAATCCCTTCGTCTACCTCGAGGTAGACGAAGGGATTGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199243.1-231s21c1
Sequence:CCGGCAAGCGTCGCAAGATGGACTTCTCGAGAAGTCCATCTTGCGACGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199243.1-41s21c1
Sequence:CCGGCCAACATTTCCGTGCCCATCTCTCGAGAGATGGGCACGGAAATGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199243.1-1044s1c1
Sequence:CCGGTCCCTTCGTCTACCTCTTCTTCTCGAGAAGAAGAGGTAGACGAAGGGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199243.1-234s1c1
Sequence:CCGGGCGTCGCAAGATGGACTTCCTCTCGAGAGGAAGTCCATCTTGCGACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199243.1-684s1c1
Sequence:CCGGCCTGCAGGTCTACGCGTTCTACTCGAGTAGAACGCGTAGACCTGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199243.1-39s1c1
Sequence:CCGGGCCCAACATTTCCGTGCCCATCTCGAGATGGGCACGGAAATGTTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199243.1-1035s1c1
Sequence:CCGGCGCTCTCAATCCCTTCGTCTACTCGAGTAGACGAAGGGATTGAGAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199243
GPR150 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 150
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199243.1-685s21c1
Sequence:CCGGCTGCAGGTCTACGCGTTCTACCTCGAGGTAGAACGCGTAGACCTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199243.1-1036s21c1
Sequence:CCGGGCTCTCAATCCCTTCGTCTACCTCGAGGTAGACGAAGGGATTGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199243.1-231s21c1
Sequence:CCGGCAAGCGTCGCAAGATGGACTTCTCGAGAAGTCCATCTTGCGACGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199243.1-41s21c1
Sequence:CCGGCCAACATTTCCGTGCCCATCTCTCGAGAGATGGGCACGGAAATGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199243.1-1044s1c1
Sequence:CCGGTCCCTTCGTCTACCTCTTCTTCTCGAGAAGAAGAGGTAGACGAAGGGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199243.1-234s1c1
Sequence:CCGGGCGTCGCAAGATGGACTTCCTCTCGAGAGGAAGTCCATCTTGCGACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199243.1-684s1c1
Sequence:CCGGCCTGCAGGTCTACGCGTTCTACTCGAGTAGAACGCGTAGACCTGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199243.1-39s1c1
Sequence:CCGGGCCCAACATTTCCGTGCCCATCTCGAGATGGGCACGGAAATGTTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199243.1-1035s1c1
Sequence:CCGGCGCTCTCAATCCCTTCGTCTACTCGAGTAGACGAAGGGATTGAGAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199243
GPR150 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 150
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199243.1-685s21c1
Sequence:CCGGCTGCAGGTCTACGCGTTCTACCTCGAGGTAGAACGCGTAGACCTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199243.1-1036s21c1
Sequence:CCGGGCTCTCAATCCCTTCGTCTACCTCGAGGTAGACGAAGGGATTGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199243.1-231s21c1
Sequence:CCGGCAAGCGTCGCAAGATGGACTTCTCGAGAAGTCCATCTTGCGACGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199243.1-41s21c1
Sequence:CCGGCCAACATTTCCGTGCCCATCTCTCGAGAGATGGGCACGGAAATGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199243.1-1044s1c1
Sequence:CCGGTCCCTTCGTCTACCTCTTCTTCTCGAGAAGAAGAGGTAGACGAAGGGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199243.1-234s1c1
Sequence:CCGGGCGTCGCAAGATGGACTTCCTCTCGAGAGGAAGTCCATCTTGCGACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199243.1-684s1c1
Sequence:CCGGCCTGCAGGTCTACGCGTTCTACTCGAGTAGAACGCGTAGACCTGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199243.1-39s1c1
Sequence:CCGGGCCCAACATTTCCGTGCCCATCTCGAGATGGGCACGGAAATGTTGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199243.1-1035s1c1
Sequence:CCGGCGCTCTCAATCCCTTCGTCTACTCGAGTAGACGAAGGGATTGAGAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)