EMAIL THIS PAGE TO A FRIEND

GPR151

G protein-coupled receptor 151

52 Gene Product Result for
Synonyms: GALR4 GALRL GPCR PGR7
UniProtKB ID: Q8TDV0, Q86SN8, Q8NGV2
Gene ID:
Mouse(240239) G protein-coupled receptor 151
Rat(307475) G protein-coupled receptor 151
Zebrafish(497134) G protein-coupled receptor 151
chicken(431416) G protein-coupled receptor 151
domestic cat(101083825) G protein-coupled receptor 151
Horse(100060990) G protein-coupled receptor 151
cow(787899) G protein-coupled receptor 151
dog(487201) G protein-coupled receptor 151
sheep(101108132) G protein-coupled receptor 151
domestic guinea pig(100731602) G protein-coupled receptor 151
naked mole-rat(101704841) G protein-coupled receptor 151
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181543 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181543 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181543 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_194251 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_194251 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_194251 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_194251 Rosetta Predictions human pricing
NM_181633 Rosetta Predictions rat pricing
NM_181543 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194251 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196721 predicted 576
2 SASI_Hs01_00196722 predicted 389
3 SASI_Hs01_00196723 predicted 620
4 SASI_Hs02_00371367 predicted 940
5 SASI_Hs01_00196724 predicted 529
6 SASI_Hs01_00196725 predicted 378
7 SASI_Hs01_00196727 predicted 432
8 SASI_Hs01_00196729 predicted 731
9 SASI_Hs02_00371368 predicted 532
10 SASI_Hs01_00196730 predicted 665
11 SASI_Hs01_00196726 predicted 205
12 SASI_Hs01_00196728 predicted 966
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181633 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030734 predicted 941
2 SASI_Rn01_00030735 predicted 955
3 SASI_Rn01_00030736 predicted 716
4 SASI_Rn01_00030737 predicted 918
5 SASI_Rn01_00030738 predicted 428
6 SASI_Rn01_00030739 predicted 999
7 SASI_Rn01_00030741 predicted 992
8 SASI_Rn02_00269772 predicted 434
9 SASI_Rn01_00030742 predicted 359
10 SASI_Rn02_00269773 predicted 1008
11 SASI_Rn01_00030740 predicted 346
12 SASI_Rn01_00030743 predicted 1170
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181543 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100778 predicted 1330
2 SASI_Mm01_00100779 predicted 1331
3 SASI_Mm01_00100780 predicted 706
4 SASI_Mm01_00100781 predicted 217
5 SASI_Mm01_00100782 predicted 910
6 SASI_Mm01_00100783 predicted 1333
7 SASI_Mm01_00100784 predicted 1398
8 SASI_Mm01_00100785 predicted 430
9 SASI_Mm01_00100786 predicted 755
10 SASI_Mm01_00100787 predicted 220
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181543
GPR151 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 151
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181543.1-710s1c1
Sequence:CCGGCGTTTATTTCTGGCGAGCTTACTCGAGTAAGCTCGCCAGAAATAAACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181543.1-423s1c1
Sequence:CCGGGCCAAGAGCTTGACATTTGTTCTCGAGAACAAATGTCAAGCTCTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026286    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181543.1-1406s1c1
Sequence:CCGGGCAAAGATTTCTGCTTTCAAACTCGAGTTTGAAAGCAGAAATCTTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181543.1-1248s1c1
Sequence:CCGGGCACAAGACAATGACCCTATACTCGAGTATAGGGTCATTGTCTTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181543.1-229s1c1
Sequence:CCGGGCATTCTCCTTCATGGCGTTTCTCGAGAAACGCCATGAAGGAGAATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181543
GPR151 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 151
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181543.1-710s1c1
Sequence:CCGGCGTTTATTTCTGGCGAGCTTACTCGAGTAAGCTCGCCAGAAATAAACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181543.1-423s1c1
Sequence:CCGGGCCAAGAGCTTGACATTTGTTCTCGAGAACAAATGTCAAGCTCTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026286    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181543.1-1406s1c1
Sequence:CCGGGCAAAGATTTCTGCTTTCAAACTCGAGTTTGAAAGCAGAAATCTTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181543.1-1248s1c1
Sequence:CCGGGCACAAGACAATGACCCTATACTCGAGTATAGGGTCATTGTCTTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181543.1-229s1c1
Sequence:CCGGGCATTCTCCTTCATGGCGTTTCTCGAGAAACGCCATGAAGGAGAATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181543
GPR151 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 151
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181543.1-710s1c1
Sequence:CCGGCGTTTATTTCTGGCGAGCTTACTCGAGTAAGCTCGCCAGAAATAAACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181543.1-423s1c1
Sequence:CCGGGCCAAGAGCTTGACATTTGTTCTCGAGAACAAATGTCAAGCTCTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026286    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181543.1-1406s1c1
Sequence:CCGGGCAAAGATTTCTGCTTTCAAACTCGAGTTTGAAAGCAGAAATCTTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181543.1-1248s1c1
Sequence:CCGGGCACAAGACAATGACCCTATACTCGAGTATAGGGTCATTGTCTTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181543.1-229s1c1
Sequence:CCGGGCATTCTCCTTCATGGCGTTTCTCGAGAAACGCCATGAAGGAGAATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194251
GPR151 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 151
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194251.1-912s1c1
Sequence:CCGGGAAAGGTGTATGGAAATGGATCTCGAGATCCATTTCCATACACCTTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194251.1-857s1c1
Sequence:CCGGCTTCAGCAAATCCTCTCATTTCTCGAGAAATGAGAGGATTTGCTGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194251.1-141s1c1
Sequence:CCGGCCTCCTTCACAATGCTTGGAACTCGAGTTCCAAGCATTGTGAAGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194251.1-547s1c1
Sequence:CCGGGAAGAGTTTATGTCGATGTTTCTCGAGAAACATCGACATAAACTCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194251.1-358s1c1
Sequence:CCGGGCCAAAGTATGCTTCATGTATCTCGAGATACATGAAGCATACTTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194251.2-627s21c1
Sequence:CCGGGGCATTTGGCCTTCCATTATTCTCGAGAATAATGGAAGGCCAAATGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194251.2-670s21c1
Sequence:CCGGAGAGCTTATGACCAATGTAAACTCGAGTTTACATTGGTCATAAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194251.2-718s21c1
Sequence:CCGGAGAAACCAGATACGCTCAAAGCTCGAGCTTTGAGCGTATCTGGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194251.2-26s21c1
Sequence:CCGGCTAACTCCAGCAGCATGAATGCTCGAGCATTCATGCTGCTGGAGTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194251
GPR151 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 151
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194251.1-912s1c1
Sequence:CCGGGAAAGGTGTATGGAAATGGATCTCGAGATCCATTTCCATACACCTTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194251.1-857s1c1
Sequence:CCGGCTTCAGCAAATCCTCTCATTTCTCGAGAAATGAGAGGATTTGCTGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194251.1-141s1c1
Sequence:CCGGCCTCCTTCACAATGCTTGGAACTCGAGTTCCAAGCATTGTGAAGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194251.1-547s1c1
Sequence:CCGGGAAGAGTTTATGTCGATGTTTCTCGAGAAACATCGACATAAACTCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194251.1-358s1c1
Sequence:CCGGGCCAAAGTATGCTTCATGTATCTCGAGATACATGAAGCATACTTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194251.2-627s21c1
Sequence:CCGGGGCATTTGGCCTTCCATTATTCTCGAGAATAATGGAAGGCCAAATGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194251.2-670s21c1
Sequence:CCGGAGAGCTTATGACCAATGTAAACTCGAGTTTACATTGGTCATAAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194251.2-718s21c1
Sequence:CCGGAGAAACCAGATACGCTCAAAGCTCGAGCTTTGAGCGTATCTGGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194251.2-26s21c1
Sequence:CCGGCTAACTCCAGCAGCATGAATGCTCGAGCATTCATGCTGCTGGAGTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194251
GPR151 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 151
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194251.1-912s1c1
Sequence:CCGGGAAAGGTGTATGGAAATGGATCTCGAGATCCATTTCCATACACCTTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194251.1-857s1c1
Sequence:CCGGCTTCAGCAAATCCTCTCATTTCTCGAGAAATGAGAGGATTTGCTGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194251.1-141s1c1
Sequence:CCGGCCTCCTTCACAATGCTTGGAACTCGAGTTCCAAGCATTGTGAAGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194251.1-547s1c1
Sequence:CCGGGAAGAGTTTATGTCGATGTTTCTCGAGAAACATCGACATAAACTCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194251.1-358s1c1
Sequence:CCGGGCCAAAGTATGCTTCATGTATCTCGAGATACATGAAGCATACTTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194251.2-627s21c1
Sequence:CCGGGGCATTTGGCCTTCCATTATTCTCGAGAATAATGGAAGGCCAAATGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194251.2-670s21c1
Sequence:CCGGAGAGCTTATGACCAATGTAAACTCGAGTTTACATTGGTCATAAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194251.2-718s21c1
Sequence:CCGGAGAAACCAGATACGCTCAAAGCTCGAGCTTTGAGCGTATCTGGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194251.2-26s21c1
Sequence:CCGGCTAACTCCAGCAGCATGAATGCTCGAGCATTCATGCTGCTGGAGTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)