EMAIL THIS PAGE TO A FRIEND

GPR152

G protein-coupled receptor 152

47 Gene Product Result for
Synonyms: PGR5
UniProtKB ID: Q8TDT2, Q0VD88, Q86SM0
Gene ID:
Mouse(269053) G protein-coupled receptor 152
Rat(688884) G protein-coupled receptor 152
domestic guinea pig(100733684) G protein-coupled receptor 152
naked mole-rat(101727438) G protein-coupled receptor 152
sheep(101110102) G protein-coupled receptor 152
domestic cat(101081165) G protein-coupled receptor 152
cow(783700) G protein-coupled receptor 152
Horse(100059343) G protein-coupled receptor 152
dog(612997) G protein-coupled receptor 152
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_206997 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_206997 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_206997 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_196191 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_196191 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_196191 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU135951 MISSION® esiRNA esiRNA human GPR152 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_206997 Rosetta Predictions human pricing
XM_001068698 Rosetta Predictions rat pricing
NM_206973 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206997 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178535 predicted 999
2 SASI_Hs01_00178536 predicted 1001
3 SASI_Hs01_00178537 predicted 716
4 SASI_Hs01_00178538 predicted 798
5 SASI_Hs01_00178539 predicted 839
6 SASI_Hs01_00178540 predicted 723
7 SASI_Hs01_00178541 predicted 1013
8 SASI_Hs01_00178542 predicted 552
9 SASI_Hs01_00178543 predicted 314
10 SASI_Hs02_00373689 predicted 840
11 SASI_Hs01_00178544 predicted 837
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068698 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00325519 predicted 472
2 SASI_Rn02_00325520 predicted 588
3 SASI_Rn02_00325521 predicted 903
4 SASI_Rn02_00325522 predicted 590
5 SASI_Rn02_00325523 predicted 760
6 SASI_Rn02_00325524 predicted 670
7 SASI_Rn02_00325525 predicted 885
8 SASI_Rn02_00325526 predicted 438
9 SASI_Rn02_00325527 predicted 827
10 SASI_Rn02_00325528 predicted 719
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206973 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040482 predicted 2354
2 SASI_Mm01_00040484 predicted 2321
3 SASI_Mm01_00040486 predicted 2551
4 SASI_Mm01_00040487 predicted 1420
5 SASI_Mm02_00351847 predicted 2029
6 SASI_Mm01_00040489 predicted 1697
7 SASI_Mm01_00040490 predicted 890
8 SASI_Mm01_00040491 predicted 1379
9 SASI_Mm02_00351848 predicted 1774
10 SASI_Mm02_00351849 predicted 1375
11 SASI_Mm01_00040483 predicted 1498
12 SASI_Mm01_00040485 predicted 2557
13 SASI_Mm01_00040488 predicted 2624
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_206997
GPR152 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 152
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206997.1-1004s21c1
Sequence:CCGGGCTAGATTCTGAGGGTCCAACCTCGAGGTTGGACCCTCAGAATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206997.1-726s21c1
Sequence:CCGGACCATTCTGTCAGCCTATGTGCTCGAGCACATAGGCTGACAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206997.1-843s21c1
Sequence:CCGGTCCGACTACCTGATCCTACTCCTCGAGGAGTAGGATCAGGTAGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206997.1-317s21c1
Sequence:CCGGCCGCTTCTACTACTTCCTATGCTCGAGCATAGGAAGTAGTAGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206997.1-316s1c1
Sequence:CCGGGCCGCTTCTACTACTTCCTATCTCGAGATAGGAAGTAGTAGAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206997.1-845s1c1
Sequence:CCGGCGACTACCTGATCCTACTCAACTCGAGTTGAGTAGGATCAGGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206997.1-723s1c1
Sequence:CCGGAGGACCATTCTGTCAGCCTATCTCGAGATAGGCTGACAGAATGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206997.1-264s1c1
Sequence:CCGGCAGATCCTAGAGATCCGGCATCTCGAGATGCCGGATCTCTAGGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206997.1-1003s1c1
Sequence:CCGGAGCTAGATTCTGAGGGTCCAACTCGAGTTGGACCCTCAGAATCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_206997
GPR152 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 152
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206997.1-1004s21c1
Sequence:CCGGGCTAGATTCTGAGGGTCCAACCTCGAGGTTGGACCCTCAGAATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206997.1-726s21c1
Sequence:CCGGACCATTCTGTCAGCCTATGTGCTCGAGCACATAGGCTGACAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206997.1-843s21c1
Sequence:CCGGTCCGACTACCTGATCCTACTCCTCGAGGAGTAGGATCAGGTAGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206997.1-317s21c1
Sequence:CCGGCCGCTTCTACTACTTCCTATGCTCGAGCATAGGAAGTAGTAGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206997.1-316s1c1
Sequence:CCGGGCCGCTTCTACTACTTCCTATCTCGAGATAGGAAGTAGTAGAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206997.1-845s1c1
Sequence:CCGGCGACTACCTGATCCTACTCAACTCGAGTTGAGTAGGATCAGGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206997.1-723s1c1
Sequence:CCGGAGGACCATTCTGTCAGCCTATCTCGAGATAGGCTGACAGAATGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206997.1-264s1c1
Sequence:CCGGCAGATCCTAGAGATCCGGCATCTCGAGATGCCGGATCTCTAGGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206997.1-1003s1c1
Sequence:CCGGAGCTAGATTCTGAGGGTCCAACTCGAGTTGGACCCTCAGAATCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_206997
GPR152 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 152
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206997.1-1004s21c1
Sequence:CCGGGCTAGATTCTGAGGGTCCAACCTCGAGGTTGGACCCTCAGAATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206997.1-726s21c1
Sequence:CCGGACCATTCTGTCAGCCTATGTGCTCGAGCACATAGGCTGACAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206997.1-843s21c1
Sequence:CCGGTCCGACTACCTGATCCTACTCCTCGAGGAGTAGGATCAGGTAGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206997.1-317s21c1
Sequence:CCGGCCGCTTCTACTACTTCCTATGCTCGAGCATAGGAAGTAGTAGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206997.1-316s1c1
Sequence:CCGGGCCGCTTCTACTACTTCCTATCTCGAGATAGGAAGTAGTAGAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206997.1-845s1c1
Sequence:CCGGCGACTACCTGATCCTACTCAACTCGAGTTGAGTAGGATCAGGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206997.1-723s1c1
Sequence:CCGGAGGACCATTCTGTCAGCCTATCTCGAGATAGGCTGACAGAATGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206997.1-264s1c1
Sequence:CCGGCAGATCCTAGAGATCCGGCATCTCGAGATGCCGGATCTCTAGGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206997.1-1003s1c1
Sequence:CCGGAGCTAGATTCTGAGGGTCCAACTCGAGTTGGACCCTCAGAATCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_196191
GPR152 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 152
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196191.2-910s1c1
Sequence:CCGGGCAACTTTCCAAATCCTGGAACTCGAGTTCCAGGATTTGGAAAGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196191.2-1310s1c1
Sequence:CCGGCCACTGCTTGTAGGACCTGTTCTCGAGAACAGGTCCTACAAGCAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196191.2-1831s1c1
Sequence:CCGGCCACCGTTGGATACTGTAGTTCTCGAGAACTACAGTATCCAACGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196191.2-1670s1c1
Sequence:CCGGCAACATCTGAAGGCCAGTCAACTCGAGTTGACTGGCCTTCAGATGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196191.2-1434s1c1
Sequence:CCGGGCTGCTCTATCTGGCTTTCTTCTCGAGAAGAAAGCCAGATAGAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_196191
GPR152 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 152
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196191.2-910s1c1
Sequence:CCGGGCAACTTTCCAAATCCTGGAACTCGAGTTCCAGGATTTGGAAAGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196191.2-1310s1c1
Sequence:CCGGCCACTGCTTGTAGGACCTGTTCTCGAGAACAGGTCCTACAAGCAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196191.2-1831s1c1
Sequence:CCGGCCACCGTTGGATACTGTAGTTCTCGAGAACTACAGTATCCAACGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196191.2-1670s1c1
Sequence:CCGGCAACATCTGAAGGCCAGTCAACTCGAGTTGACTGGCCTTCAGATGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196191.2-1434s1c1
Sequence:CCGGGCTGCTCTATCTGGCTTTCTTCTCGAGAAGAAAGCCAGATAGAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_196191
GPR152 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 152
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196191.2-910s1c1
Sequence:CCGGGCAACTTTCCAAATCCTGGAACTCGAGTTCCAGGATTTGGAAAGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196191.2-1310s1c1
Sequence:CCGGCCACTGCTTGTAGGACCTGTTCTCGAGAACAGGTCCTACAAGCAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196191.2-1831s1c1
Sequence:CCGGCCACCGTTGGATACTGTAGTTCTCGAGAACTACAGTATCCAACGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196191.2-1670s1c1
Sequence:CCGGCAACATCTGAAGGCCAGTCAACTCGAGTTGACTGGCCTTCAGATGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196191.2-1434s1c1
Sequence:CCGGGCTGCTCTATCTGGCTTTCTTCTCGAGAAGAAAGCCAGATAGAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks