EMAIL THIS PAGE TO A FRIEND

GPR153

G protein-coupled receptor 153

Synonyms: PGR1
UniProtKB ID: Q6NV75, Q5TGR5, Q6AHW8, Q86SP8
Gene ID:
Mouse(100129) G protein-coupled receptor 153
Rat(619550) G protein-coupled receptor 153
chicken(100859891) G protein-coupled receptor 153
cow(518906) G protein-coupled receptor 153
domestic cat(101093874) G protein-coupled receptor 153
dog(489630) G protein-coupled receptor 153
sheep(101122042) G protein-coupled receptor 153
domestic guinea pig(100725480) G protein-coupled receptor 153
naked mole-rat(101707676) G protein-coupled receptor 153
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207370 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207370 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207370 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178406 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178406 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178406 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU062671 MISSION® esiRNA esiRNA targeting mouse Gpr153 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207370 Rosetta Predictions human pricing
NM_001034855 Rosetta Predictions rat pricing
NM_178406 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207370 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110230 predicted 655
2 SASI_Hs01_00110231 predicted 1035
3 SASI_Hs01_00110232 predicted 1288
4 SASI_Hs01_00110233 predicted 1314
5 SASI_Hs01_00110234 predicted 998
6 SASI_Hs02_00373969 predicted 743
7 SASI_Hs01_00110235 predicted 638
8 SASI_Hs01_00110236 predicted 2214
9 SASI_Hs01_00110237 predicted 987
10 SASI_Hs01_00110239 predicted 979
11 SASI_Hs01_00110238 predicted 1395
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034855 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058570 predicted 2153
2 SASI_Rn01_00058571 predicted 2128
3 SASI_Rn01_00058572 predicted 2375
4 SASI_Rn01_00058573 predicted 580
5 SASI_Rn01_00058574 predicted 1101
6 SASI_Rn01_00058577 predicted 1132
7 SASI_Rn01_00058578 predicted 574
8 SASI_Rn02_00204045 predicted 2067
9 SASI_Rn01_00058579 predicted 2367
10 SASI_Rn02_00204046 predicted 563
11 SASI_Rn01_00058575 predicted 2172
12 SASI_Rn01_00058576 predicted 1100
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178406 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109804 predicted 2151
2 SASI_Mm01_00109805 predicted 1157
3 SASI_Mm01_00109806 predicted 2359
4 SASI_Mm01_00109807 predicted 1179
5 SASI_Mm01_00109809 predicted 1144
6 SASI_Mm01_00109810 predicted 376
7 SASI_Mm02_00348838 predicted 611
8 SASI_Mm01_00109811 predicted 312
9 SASI_Mm01_00109812 predicted 515
10 SASI_Mm01_00109813 predicted 395
11 SASI_Mm01_00109808 predicted 1076
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207370
GPR153 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 153
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207370.1-1397s1c1
Sequence:CCGGGCAGGAGGACAAGATGCAATACTCGAGTATTGCATCTTGTCCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207370.1-359s1c1
Sequence:CCGGCGCCAAGCAGAAGAAGTGGAACTCGAGTTCCACTTCTTCTGCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207370.1-1322s1c1
Sequence:CCGGCCTAGATAGGATGGCCAAGTACTCGAGTACTTGGCCATCCTATCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207370.1-1295s1c1
Sequence:CCGGCTATGGCTATGGAGGTGATTTCTCGAGAAATCACCTCCATAGCCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207370.1-995s1c1
Sequence:CCGGCGTGACCACCATAGTCTTCATCTCGAGATGAAGACTATGGTGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207370.1-994s21c1
Sequence:CCGGTCGTGACCACCATAGTCTTCACTCGAGTGAAGACTATGGTGGTCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207370.1-1324s21c1
Sequence:CCGGTAGATAGGATGGCCAAGTATGCTCGAGCATACTTGGCCATCCTATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207370.1-1398s21c1
Sequence:CCGGCAGGAGGACAAGATGCAATACCTCGAGGTATTGCATCTTGTCCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207370
GPR153 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 153
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207370.1-1397s1c1
Sequence:CCGGGCAGGAGGACAAGATGCAATACTCGAGTATTGCATCTTGTCCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207370.1-359s1c1
Sequence:CCGGCGCCAAGCAGAAGAAGTGGAACTCGAGTTCCACTTCTTCTGCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207370.1-1322s1c1
Sequence:CCGGCCTAGATAGGATGGCCAAGTACTCGAGTACTTGGCCATCCTATCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207370.1-1295s1c1
Sequence:CCGGCTATGGCTATGGAGGTGATTTCTCGAGAAATCACCTCCATAGCCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207370.1-995s1c1
Sequence:CCGGCGTGACCACCATAGTCTTCATCTCGAGATGAAGACTATGGTGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207370.1-994s21c1
Sequence:CCGGTCGTGACCACCATAGTCTTCACTCGAGTGAAGACTATGGTGGTCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207370.1-1324s21c1
Sequence:CCGGTAGATAGGATGGCCAAGTATGCTCGAGCATACTTGGCCATCCTATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207370.1-1398s21c1
Sequence:CCGGCAGGAGGACAAGATGCAATACCTCGAGGTATTGCATCTTGTCCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207370
GPR153 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 153
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207370.1-1397s1c1
Sequence:CCGGGCAGGAGGACAAGATGCAATACTCGAGTATTGCATCTTGTCCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207370.1-359s1c1
Sequence:CCGGCGCCAAGCAGAAGAAGTGGAACTCGAGTTCCACTTCTTCTGCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207370.1-1322s1c1
Sequence:CCGGCCTAGATAGGATGGCCAAGTACTCGAGTACTTGGCCATCCTATCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207370.1-1295s1c1
Sequence:CCGGCTATGGCTATGGAGGTGATTTCTCGAGAAATCACCTCCATAGCCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207370.1-995s1c1
Sequence:CCGGCGTGACCACCATAGTCTTCATCTCGAGATGAAGACTATGGTGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207370.1-994s21c1
Sequence:CCGGTCGTGACCACCATAGTCTTCACTCGAGTGAAGACTATGGTGGTCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207370.1-1324s21c1
Sequence:CCGGTAGATAGGATGGCCAAGTATGCTCGAGCATACTTGGCCATCCTATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207370.1-1398s21c1
Sequence:CCGGCAGGAGGACAAGATGCAATACCTCGAGGTATTGCATCTTGTCCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178406
VALIDATED
GPR153 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 153
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000026126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178406.1-1092s1c1
Sequence:CCGGCGACGAAGATTCTGACAATGACTCGAGTCATTGTCAGAATCTTCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178406.1-837s1c1
Sequence:CCGGTGCCAGAACTTCGCTACAGATCTCGAGATCTGTAGCGAAGTTCTGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178406.1-616s1c1
Sequence:CCGGCGCTTCATCGTGGCCGAGATTCTCGAGAATCTCGGCCACGATGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178406.1-1156s1c1
Sequence:CCGGCGCTCTCTTGACTATAGCTATCTCGAGATAGCTATAGTCAAGAGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178406
VALIDATED
GPR153 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 153
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000026126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178406.1-1092s1c1
Sequence:CCGGCGACGAAGATTCTGACAATGACTCGAGTCATTGTCAGAATCTTCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178406.1-837s1c1
Sequence:CCGGTGCCAGAACTTCGCTACAGATCTCGAGATCTGTAGCGAAGTTCTGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178406.1-616s1c1
Sequence:CCGGCGCTTCATCGTGGCCGAGATTCTCGAGAATCTCGGCCACGATGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178406.1-1156s1c1
Sequence:CCGGCGCTCTCTTGACTATAGCTATCTCGAGATAGCTATAGTCAAGAGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178406
VALIDATED
GPR153 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 153
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000026126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178406.1-1092s1c1
Sequence:CCGGCGACGAAGATTCTGACAATGACTCGAGTCATTGTCAGAATCTTCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178406.1-837s1c1
Sequence:CCGGTGCCAGAACTTCGCTACAGATCTCGAGATCTGTAGCGAAGTTCTGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178406.1-616s1c1
Sequence:CCGGCGCTTCATCGTGGCCGAGATTCTCGAGAATCTCGGCCACGATGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178406.1-1156s1c1
Sequence:CCGGCGCTCTCTTGACTATAGCTATCTCGAGATAGCTATAGTCAAGAGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks