EMAIL THIS PAGE TO A FRIEND

GPR155

G protein-coupled receptor 155

128 Gene Product Result for
Synonyms: DEP.7 DEPDC3 PGR22
Gene ID:
Mouse(68526) G protein-coupled receptor 155
Rat(311730) G protein-coupled receptor 155
domestic guinea pig(100726887) G protein-coupled receptor 155
naked mole-rat(101714095) G protein-coupled receptor 155
sheep(101110651) G protein-coupled receptor 155
chicken(426454) G protein-coupled receptor 155
dog(488408) G protein-coupled receptor 155
domestic cat(101095911) G protein-coupled receptor 155
Horse(100053256) G protein-coupled receptor 155
cow(538798) G protein-coupled receptor 155
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152529 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152529 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152529 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001080707 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001080707 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001080707 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033045 Rosetta Predictions human pricing
NM_152529 Rosetta Predictions human pricing
NM_001107811 Rosetta Predictions rat pricing
NM_001080707 Rosetta Predictions mouse pricing
XM_130346 Rosetta Predictions mouse pricing
XM_895954 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033045 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307975 predicted 1815
2 SASI_Hs01_00025977 predicted 1494
3 SASI_Hs01_00025978 predicted 1034
4 SASI_Hs01_00025980 predicted 1909
5 SASI_Hs01_00025981 predicted 1460
6 SASI_Hs01_00025982 predicted 1516
7 SASI_Hs02_00307976 predicted 1376
8 SASI_Hs01_00025985 predicted 1213
9 SASI_Hs02_00307977 predicted 745
10 SASI_Hs02_00307978 predicted 918
11 SASI_Hs01_00025979 predicted 1623
12 SASI_Hs01_00025983 predicted 1323
13 SASI_Hs01_00025984 predicted 1276
14 SASI_Hs01_00025986 predicted 2400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152529 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366329 predicted 1661
2 SASI_Hs01_00074123 predicted 1341
3 SASI_Hs01_00074124 predicted 885
4 SASI_Hs01_00074126 predicted 1767
5 SASI_Hs01_00074127 predicted 1307
6 SASI_Hs01_00074128 predicted 1362
7 SASI_Hs02_00366330 predicted 1229
8 SASI_Hs01_00074130 predicted 1073
9 SASI_Hs02_00366331 predicted 599
10 SASI_Hs02_00366332 predicted 772
11 SASI_Hs01_00074125 predicted 1472
12 SASI_Hs01_00074129 predicted 1171
13 SASI_Hs01_00074131 predicted 2257
14 SASI_Hs01_00074132 predicted 881
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107811 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232505 predicted 2786
2 SASI_Rn02_00232506 predicted 1360
3 SASI_Rn02_00232507 predicted 2536
4 SASI_Rn02_00232508 predicted 1458
5 SASI_Rn02_00232509 predicted 445
6 SASI_Rn02_00232510 predicted 870
7 SASI_Rn02_00232511 predicted 1473
8 SASI_Rn02_00232512 predicted 2689
9 SASI_Rn02_00232513 predicted 1493
10 SASI_Rn02_00232514 predicted 1845
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080707 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293533 predicted 1456
2 SASI_Mm02_00293534 predicted 2142
3 SASI_Mm02_00293535 predicted 959
4 SASI_Mm02_00293536 predicted 1843
5 SASI_Mm02_00293537 predicted 1452
6 SASI_Mm02_00293538 predicted 1593
7 SASI_Mm02_00293539 predicted 1588
8 SASI_Mm02_00293540 predicted 2114
9 SASI_Mm02_00293541 predicted 1586
10 SASI_Mm02_00293542 predicted 1246
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_130346 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00273577 predicted 1159
2 SASI_Mm01_00273578 predicted 1852
3 SASI_Mm01_00273579 predicted 660
4 SASI_Mm01_00273580 predicted 1547
5 SASI_Mm01_00273581 predicted 1154
6 SASI_Mm01_00273582 predicted 1821
7 SASI_Mm01_00273583 predicted 1291
8 SASI_Mm01_00273584 predicted 950
9 SASI_Mm01_00273585 predicted 2273
10 SASI_Mm01_00273586 predicted 679
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895954 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00247106 predicted 1636
2 SASI_Mm01_00247107 predicted 2323
3 SASI_Mm01_00247108 predicted 1132
4 SASI_Mm01_00247109 predicted 2025
5 SASI_Mm01_00247110 predicted 1633
6 SASI_Mm01_00247111 predicted 2302
7 SASI_Mm01_00247112 predicted 1769
8 SASI_Mm01_00247113 predicted 1423
9 SASI_Mm01_00247114 predicted 1153
10 SASI_Mm01_00247115 predicted 1512
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152529
VALIDATED
GPR155 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 155
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152529.5-2339s21c1
Sequence:CCGGTAACTTTGGTCAGGGATTTATCTCGAGATAAATCCCTGACCAAAGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152529.5-269s21c1
Sequence:CCGGCTTAACCATTGCAGTCAATATCTCGAGATATTGACTGCAATGGTTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152529.5-866s21c1
Sequence:CCGGACTCGGACTCCTGCGTGTATTCTCGAGAATACACGCAGGAGTCCGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152529.5-1061s21c1
Sequence:CCGGGTCGGCATTTGTAGTACTAATCTCGAGATTAGTACTACAAATGCCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152529.3-315s1c1
Sequence:CCGGGCATGGATTTAATTCCACTAACTCGAGTTAGTGGAATTAAATCCATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008282    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152529.3-2956s1c1
Sequence:CCGGGCCTCAGTTGTCTCTTCTGTACTCGAGTACAGAAGAGACAACTGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152529.3-2489s1c1
Sequence:CCGGCCTGTCAACAATTTATCCATTCTCGAGAATGGATAAATTGTTGACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152529.3-1966s1c1
Sequence:CCGGCCAGTAAATGAACCAGAACTTCTCGAGAAGTTCTGGTTCATTTACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152529.3-727s1c1
Sequence:CCGGCCAGAATATCTCCAGTACATTCTCGAGAATGTACTGGAGATATTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152529
VALIDATED
GPR155 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 155
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152529.5-2339s21c1
Sequence:CCGGTAACTTTGGTCAGGGATTTATCTCGAGATAAATCCCTGACCAAAGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152529.5-269s21c1
Sequence:CCGGCTTAACCATTGCAGTCAATATCTCGAGATATTGACTGCAATGGTTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152529.5-866s21c1
Sequence:CCGGACTCGGACTCCTGCGTGTATTCTCGAGAATACACGCAGGAGTCCGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152529.5-1061s21c1
Sequence:CCGGGTCGGCATTTGTAGTACTAATCTCGAGATTAGTACTACAAATGCCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152529.3-315s1c1
Sequence:CCGGGCATGGATTTAATTCCACTAACTCGAGTTAGTGGAATTAAATCCATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008282    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152529.3-2956s1c1
Sequence:CCGGGCCTCAGTTGTCTCTTCTGTACTCGAGTACAGAAGAGACAACTGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152529.3-2489s1c1
Sequence:CCGGCCTGTCAACAATTTATCCATTCTCGAGAATGGATAAATTGTTGACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152529.3-1966s1c1
Sequence:CCGGCCAGTAAATGAACCAGAACTTCTCGAGAAGTTCTGGTTCATTTACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152529.3-727s1c1
Sequence:CCGGCCAGAATATCTCCAGTACATTCTCGAGAATGTACTGGAGATATTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152529
VALIDATED
GPR155 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 155
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152529.5-2339s21c1
Sequence:CCGGTAACTTTGGTCAGGGATTTATCTCGAGATAAATCCCTGACCAAAGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152529.5-269s21c1
Sequence:CCGGCTTAACCATTGCAGTCAATATCTCGAGATATTGACTGCAATGGTTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152529.5-866s21c1
Sequence:CCGGACTCGGACTCCTGCGTGTATTCTCGAGAATACACGCAGGAGTCCGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152529.5-1061s21c1
Sequence:CCGGGTCGGCATTTGTAGTACTAATCTCGAGATTAGTACTACAAATGCCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152529.3-315s1c1
Sequence:CCGGGCATGGATTTAATTCCACTAACTCGAGTTAGTGGAATTAAATCCATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008282    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152529.3-2956s1c1
Sequence:CCGGGCCTCAGTTGTCTCTTCTGTACTCGAGTACAGAAGAGACAACTGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152529.3-2489s1c1
Sequence:CCGGCCTGTCAACAATTTATCCATTCTCGAGAATGGATAAATTGTTGACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152529.3-1966s1c1
Sequence:CCGGCCAGTAAATGAACCAGAACTTCTCGAGAAGTTCTGGTTCATTTACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152529.3-727s1c1
Sequence:CCGGCCAGAATATCTCCAGTACATTCTCGAGAATGTACTGGAGATATTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080707
VALIDATED
GPR155 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 155
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080707.1-421s21c1
Sequence:CCGGATCCACCTTCGATGTCGATAACTCGAGTTATCGACATCGAAGGTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080707.1-1558s21c1
Sequence:CCGGATATGCTCACAGCGAACTTACCTCGAGGTAAGTTCGCTGTGAGCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080707.1-1333s21c1
Sequence:CCGGACATGGAAGTGGAGATTATAACTCGAGTTATAATCTCCACTTCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080707.1-561s21c1
Sequence:CCGGTTTGCCCTTCCAGCCTTATTACTCGAGTAATAAGGCTGGAAGGGCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080707.1-495s21c1
Sequence:CCGGATAGCAGGAAGGGCCAATATCCTCGAGGATATTGGCCCTTCCTGCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080707.1-967s21c1
Sequence:CCGGTACAGAACCCGATAGTATTTACTCGAGTAAATACTATCGGGTTCTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080707.1-356s21c1
Sequence:CCGGCTCAACGCTTGCTGGTGATATCTCGAGATATCACCAGCAAGCGTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080707.1-671s21c1
Sequence:CCGGTGTGTGTGTATTAACCTTATTCTCGAGAATAAGGTTAATACACACACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080707.1-812s21c1
Sequence:CCGGAGAGTATCTGCAGTACATTTACTCGAGTAAATGTACTGCAGATACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080707
VALIDATED
GPR155 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 155
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080707.1-421s21c1
Sequence:CCGGATCCACCTTCGATGTCGATAACTCGAGTTATCGACATCGAAGGTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080707.1-1558s21c1
Sequence:CCGGATATGCTCACAGCGAACTTACCTCGAGGTAAGTTCGCTGTGAGCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080707.1-1333s21c1
Sequence:CCGGACATGGAAGTGGAGATTATAACTCGAGTTATAATCTCCACTTCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080707.1-561s21c1
Sequence:CCGGTTTGCCCTTCCAGCCTTATTACTCGAGTAATAAGGCTGGAAGGGCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080707.1-495s21c1
Sequence:CCGGATAGCAGGAAGGGCCAATATCCTCGAGGATATTGGCCCTTCCTGCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080707.1-967s21c1
Sequence:CCGGTACAGAACCCGATAGTATTTACTCGAGTAAATACTATCGGGTTCTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080707.1-356s21c1
Sequence:CCGGCTCAACGCTTGCTGGTGATATCTCGAGATATCACCAGCAAGCGTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080707.1-671s21c1
Sequence:CCGGTGTGTGTGTATTAACCTTATTCTCGAGAATAAGGTTAATACACACACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080707.1-812s21c1
Sequence:CCGGAGAGTATCTGCAGTACATTTACTCGAGTAAATGTACTGCAGATACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080707
VALIDATED
GPR155 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 155
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080707.1-421s21c1
Sequence:CCGGATCCACCTTCGATGTCGATAACTCGAGTTATCGACATCGAAGGTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080707.1-1558s21c1
Sequence:CCGGATATGCTCACAGCGAACTTACCTCGAGGTAAGTTCGCTGTGAGCATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080707.1-1333s21c1
Sequence:CCGGACATGGAAGTGGAGATTATAACTCGAGTTATAATCTCCACTTCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080707.1-561s21c1
Sequence:CCGGTTTGCCCTTCCAGCCTTATTACTCGAGTAATAAGGCTGGAAGGGCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080707.1-495s21c1
Sequence:CCGGATAGCAGGAAGGGCCAATATCCTCGAGGATATTGGCCCTTCCTGCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080707.1-967s21c1
Sequence:CCGGTACAGAACCCGATAGTATTTACTCGAGTAAATACTATCGGGTTCTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080707.1-356s21c1
Sequence:CCGGCTCAACGCTTGCTGGTGATATCTCGAGATATCACCAGCAAGCGTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080707.1-671s21c1
Sequence:CCGGTGTGTGTGTATTAACCTTATTCTCGAGAATAAGGTTAATACACACACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080707.1-812s21c1
Sequence:CCGGAGAGTATCTGCAGTACATTTACTCGAGTAAATGTACTGCAGATACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)