EMAIL THIS PAGE TO A FRIEND

GPR157

G protein-coupled receptor 157

61 Gene Product Result for
UniProtKB ID: Q5UAW9, A2A334, Q8WWB8, Q9HA73
Gene ID:
Mouse(269604) G protein-coupled receptor 157
Rat(313725) G protein-coupled receptor 157
domestic guinea pig(100729546) G protein-coupled receptor 157
naked mole-rat(101707186) G protein-coupled receptor 157
Zebrafish(555274) G protein-coupled receptor 157
cow(538468) G protein-coupled receptor 157
domestic cat(101097821) G protein-coupled receptor 157
dog(608460) G protein-coupled receptor 157
chicken(419439) G protein-coupled receptor 157
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024980 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024980 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024980 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177366 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177366 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177366 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU070041 MISSION® esiRNA esiRNA targeting mouse Gpr157 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024980 Rosetta Predictions human pricing
NM_001012107 Rosetta Predictions rat pricing
XM_575961 Rosetta Predictions rat pricing
NM_177366 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024980 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139064 predicted 429
2 SASI_Hs01_00139065 predicted 496
3 SASI_Hs01_00139066 predicted 391
4 SASI_Hs01_00139068 predicted 672
5 SASI_Hs02_00357640 predicted 833
6 SASI_Hs01_00139069 predicted 744
7 SASI_Hs01_00139070 predicted 437
8 SASI_Hs01_00139071 predicted 924
9 SASI_Hs01_00139072 predicted 323
10 SASI_Hs01_00139073 predicted 441
11 SASI_Hs01_00139067 predicted 512
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012107 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053495 predicted 1404
2 SASI_Rn01_00053496 predicted 483
3 SASI_Rn01_00053497 predicted 1632
4 SASI_Rn01_00053498 predicted 651
5 SASI_Rn01_00053499 predicted 1219
6 SASI_Rn01_00053500 predicted 1563
7 SASI_Rn02_00200253 predicted 1601
8 SASI_Rn01_00053502 predicted 1512
9 SASI_Rn01_00053503 predicted 546
10 SASI_Rn02_00200254 predicted 633
11 SASI_Rn01_00053494 predicted 1057
12 SASI_Rn01_00053501 predicted 536
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575961 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00159053 predicted 425
2 SASI_Rn01_00159054 predicted 370
3 SASI_Rn01_00159055 predicted 651
4 SASI_Rn01_00159056 predicted 541
5 SASI_Rn01_00159057 predicted 420
6 SASI_Rn01_00159058 predicted 654
7 SASI_Rn01_00159059 predicted 433
8 SASI_Rn01_00159060 predicted 516
9 SASI_Rn01_00159061 predicted 551
10 SASI_Rn01_00159062 predicted 428
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177366 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079465 predicted 1466
2 SASI_Mm01_00079466 predicted 1028
3 SASI_Mm01_00079467 predicted 936
4 SASI_Mm01_00079468 predicted 496
5 SASI_Mm01_00079469 predicted 665
6 SASI_Mm02_00347521 predicted 1690
7 SASI_Mm01_00079470 predicted 974
8 SASI_Mm01_00079471 predicted 642
9 SASI_Mm01_00079472 predicted 1281
10 SASI_Mm01_00079473 predicted 791
11 SASI_Mm01_00079464 predicted 1921
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024980
GPR157 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 157
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024980.4-436s21c1
Sequence:CCGGTGGCCATTGCGCTCTACTTGTCTCGAGACAAGTAGAGCGCAATGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024980.4-669s21c1
Sequence:CCGGCTGTGGGAGATGCTGGCATATCTCGAGATATGCCAGCATCTCCCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024980.4-715s21c1
Sequence:CCGGTGGTCCGGAAGCACATCAACACTCGAGTGTTGATGTGCTTCCGGACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024980.4-565s21c1
Sequence:CCGGCCCTGAAGAAGATTGGCTATGCTCGAGCATAGCCAATCTTCTTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024980.4-934s21c1
Sequence:CCGGATGGTATCGGGAACACGTTTCCTCGAGGAAACGTGTTCCCGATACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008275    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024980.2-1342s1c1
Sequence:CCGGCCAAGACCTTACTTTGCGATTCTCGAGAATCGCAAAGTAAGGTCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024980.2-619s1c1
Sequence:CCGGCTCGCACAGATCGCCTGCTTTCTCGAGAAAGCAGGCGATCTGTGCGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024980.2-578s1c1
Sequence:CCGGGCTCTACTTGTACCTCAGCATCTCGAGATGCTGAGGTACAAGTAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024980.2-458s1c1
Sequence:CCGGCGCCTCCTACTTCTACGGAGTCTCGAGACTCCGTAGAAGTAGGAGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024980
GPR157 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 157
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024980.4-436s21c1
Sequence:CCGGTGGCCATTGCGCTCTACTTGTCTCGAGACAAGTAGAGCGCAATGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024980.4-669s21c1
Sequence:CCGGCTGTGGGAGATGCTGGCATATCTCGAGATATGCCAGCATCTCCCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024980.4-715s21c1
Sequence:CCGGTGGTCCGGAAGCACATCAACACTCGAGTGTTGATGTGCTTCCGGACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024980.4-565s21c1
Sequence:CCGGCCCTGAAGAAGATTGGCTATGCTCGAGCATAGCCAATCTTCTTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024980.4-934s21c1
Sequence:CCGGATGGTATCGGGAACACGTTTCCTCGAGGAAACGTGTTCCCGATACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008275    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024980.2-1342s1c1
Sequence:CCGGCCAAGACCTTACTTTGCGATTCTCGAGAATCGCAAAGTAAGGTCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024980.2-619s1c1
Sequence:CCGGCTCGCACAGATCGCCTGCTTTCTCGAGAAAGCAGGCGATCTGTGCGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024980.2-578s1c1
Sequence:CCGGGCTCTACTTGTACCTCAGCATCTCGAGATGCTGAGGTACAAGTAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024980.2-458s1c1
Sequence:CCGGCGCCTCCTACTTCTACGGAGTCTCGAGACTCCGTAGAAGTAGGAGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024980
GPR157 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 157
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024980.4-436s21c1
Sequence:CCGGTGGCCATTGCGCTCTACTTGTCTCGAGACAAGTAGAGCGCAATGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024980.4-669s21c1
Sequence:CCGGCTGTGGGAGATGCTGGCATATCTCGAGATATGCCAGCATCTCCCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024980.4-715s21c1
Sequence:CCGGTGGTCCGGAAGCACATCAACACTCGAGTGTTGATGTGCTTCCGGACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024980.4-565s21c1
Sequence:CCGGCCCTGAAGAAGATTGGCTATGCTCGAGCATAGCCAATCTTCTTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024980.4-934s21c1
Sequence:CCGGATGGTATCGGGAACACGTTTCCTCGAGGAAACGTGTTCCCGATACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008275    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024980.2-1342s1c1
Sequence:CCGGCCAAGACCTTACTTTGCGATTCTCGAGAATCGCAAAGTAAGGTCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024980.2-619s1c1
Sequence:CCGGCTCGCACAGATCGCCTGCTTTCTCGAGAAAGCAGGCGATCTGTGCGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024980.2-578s1c1
Sequence:CCGGGCTCTACTTGTACCTCAGCATCTCGAGATGCTGAGGTACAAGTAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024980.2-458s1c1
Sequence:CCGGCGCCTCCTACTTCTACGGAGTCTCGAGACTCCGTAGAAGTAGGAGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177366
GPR157 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 157
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177366.2-806s1c1
Sequence:CCGGGCCGTCTCTCTAAAGAAGATACTCGAGTATCTTCTTTAGAGAGACGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177366.2-640s1c1
Sequence:CCGGCGCTCTCTCTACTTTCGCCAACTCGAGTTGGCGAAAGTAGAGAGAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177366.2-1064s1c1
Sequence:CCGGGATAAGAAGTTGGTCCTCATTCTCGAGAATGAGGACCAACTTCTTATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177366.2-1183s1c1
Sequence:CCGGGCATGGCATTGGAAACACCTTCTCGAGAAGGTGTTTCCAATGCCATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177366.2-1172s1c1
Sequence:CCGGCTGGTTGTTCTGCATGGCATTCTCGAGAATGCCATGCAGAACAACCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177366
GPR157 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 157
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177366.2-806s1c1
Sequence:CCGGGCCGTCTCTCTAAAGAAGATACTCGAGTATCTTCTTTAGAGAGACGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177366.2-640s1c1
Sequence:CCGGCGCTCTCTCTACTTTCGCCAACTCGAGTTGGCGAAAGTAGAGAGAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177366.2-1064s1c1
Sequence:CCGGGATAAGAAGTTGGTCCTCATTCTCGAGAATGAGGACCAACTTCTTATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177366.2-1183s1c1
Sequence:CCGGGCATGGCATTGGAAACACCTTCTCGAGAAGGTGTTTCCAATGCCATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177366.2-1172s1c1
Sequence:CCGGCTGGTTGTTCTGCATGGCATTCTCGAGAATGCCATGCAGAACAACCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177366
GPR157 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 157
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177366.2-806s1c1
Sequence:CCGGGCCGTCTCTCTAAAGAAGATACTCGAGTATCTTCTTTAGAGAGACGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177366.2-640s1c1
Sequence:CCGGCGCTCTCTCTACTTTCGCCAACTCGAGTTGGCGAAAGTAGAGAGAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177366.2-1064s1c1
Sequence:CCGGGATAAGAAGTTGGTCCTCATTCTCGAGAATGAGGACCAACTTCTTATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177366.2-1183s1c1
Sequence:CCGGGCATGGCATTGGAAACACCTTCTCGAGAAGGTGTTTCCAATGCCATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177366.2-1172s1c1
Sequence:CCGGCTGGTTGTTCTGCATGGCATTCTCGAGAATGCCATGCAGAACAACCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)