EMAIL THIS PAGE TO A FRIEND

GPR158

G protein-coupled receptor 158

211 Gene Product Result for
Synonyms: RP11-59G22.1
UniProtKB ID: Q5T848, Q6QR81, Q9ULT3
Gene ID:
Mouse(241263) G protein-coupled receptor 158
Rat(291352) G protein-coupled receptor 158
chicken(100859400) threonine synthase-like 1 (S. cerevisiae)
dog(477984) G protein-coupled receptor 158
domestic cat(101086730) G protein-coupled receptor 158
cow(538123) G protein-coupled receptor 158
sheep(101106191) G protein-coupled receptor 158
Domestic Rabbit(100356312) G protein-coupled receptor 158
domestic guinea pig(100735424) G protein-coupled receptor 158
naked mole-rat(101700121) G protein-coupled receptor 158
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_140850 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_140850 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_140850 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020752 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020752 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020752 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020752 Rosetta Predictions human pricing
XM_225625 Rosetta Predictions rat pricing
NM_001004761 Rosetta Predictions mouse pricing
NM_175706 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020752 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052597 predicted 1645
2 SASI_Hs01_00052598 predicted 2063
3 SASI_Hs02_00353873 predicted 1181
4 SASI_Hs01_00052599 predicted 997
5 SASI_Hs01_00052600 predicted 1891
6 SASI_Hs01_00052602 predicted 1446
7 SASI_Hs02_00353874 predicted 2885
8 SASI_Hs01_00052604 predicted 3498
9 SASI_Hs01_00052605 predicted 2512
10 SASI_Hs01_00052606 predicted 1069
11 SASI_Hs01_00052601 predicted 963
12 SASI_Hs01_00052603 predicted 849
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225625 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382964 predicted 3702
2 SASI_Rn02_00382965 predicted 3125
3 SASI_Rn02_00382966 predicted 4567
4 SASI_Rn02_00382967 predicted 3069
5 SASI_Rn02_00382968 predicted 4163
6 SASI_Rn02_00382969 predicted 4097
7 SASI_Rn02_00382970 predicted 4429
8 SASI_Rn02_00382971 predicted 4083
9 SASI_Rn02_00382972 predicted 4074
10 SASI_Rn02_00382973 predicted 2949
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004761 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00286551 predicted 4215
2 SASI_Mm01_00166242 predicted 2274
3 SASI_Mm01_00166244 predicted 2330
4 SASI_Mm02_00286552 predicted 3145
5 SASI_Mm02_00286553 predicted 3850
6 SASI_Mm01_00166247 predicted 1348
7 SASI_Mm01_00166248 predicted 1624
8 SASI_Mm01_00166250 predicted 2108
9 SASI_Mm02_00286554 predicted 1612
10 SASI_Mm02_00286555 predicted 2639
11 SASI_Mm01_00166241 predicted 1835
12 SASI_Mm01_00166243 predicted 1684
13 SASI_Mm01_00166245 predicted 1722
14 SASI_Mm01_00166246 predicted 1732
15 SASI_Mm01_00166249 predicted 1597
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175706 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146211 predicted 1830
2 SASI_Mm01_00146212 predicted 2286
3 SASI_Mm01_00146213 predicted 1676
4 SASI_Mm01_00146214 predicted 2335
5 SASI_Mm01_00146215 predicted 1719
6 SASI_Mm01_00146216 predicted 1733
7 SASI_Mm01_00146217 predicted 1350
8 SASI_Mm01_00146218 predicted 1633
9 SASI_Mm01_00146219 predicted 1592
10 SASI_Mm01_00146220 predicted 2114
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_140850
GPR158 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 158
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140850.3-1682s1c1
Sequence:CCGGCCTTAACAACTCAGAGTGTATCTCGAGATACACTCTGAGTTGTTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140850.3-2091s1c1
Sequence:CCGGCCGGTCGTTATTCTGTACTTTCTCGAGAAAGTACAGAATAACGACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140850.3-2114s1c1
Sequence:CCGGGCCAAGTACATTTCGTTGTATCTCGAGATACAACGAAATGTACTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140850.3-2549s1c1
Sequence:CCGGGCTCATTATCACGGCTATATTCTCGAGAATATAGCCGTGATAATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140850.3-2560s1c1
Sequence:CCGGCGGCTATATTCCATACAATTACTCGAGTAATTGTATGGAATATAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_140850
GPR158 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 158
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140850.3-1682s1c1
Sequence:CCGGCCTTAACAACTCAGAGTGTATCTCGAGATACACTCTGAGTTGTTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140850.3-2091s1c1
Sequence:CCGGCCGGTCGTTATTCTGTACTTTCTCGAGAAAGTACAGAATAACGACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140850.3-2114s1c1
Sequence:CCGGGCCAAGTACATTTCGTTGTATCTCGAGATACAACGAAATGTACTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140850.3-2549s1c1
Sequence:CCGGGCTCATTATCACGGCTATATTCTCGAGAATATAGCCGTGATAATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140850.3-2560s1c1
Sequence:CCGGCGGCTATATTCCATACAATTACTCGAGTAATTGTATGGAATATAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_140850
GPR158 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 158
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140850.3-1682s1c1
Sequence:CCGGCCTTAACAACTCAGAGTGTATCTCGAGATACACTCTGAGTTGTTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140850.3-2091s1c1
Sequence:CCGGCCGGTCGTTATTCTGTACTTTCTCGAGAAAGTACAGAATAACGACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140850.3-2114s1c1
Sequence:CCGGGCCAAGTACATTTCGTTGTATCTCGAGATACAACGAAATGTACTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140850.3-2549s1c1
Sequence:CCGGGCTCATTATCACGGCTATATTCTCGAGAATATAGCCGTGATAATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140850.3-2560s1c1
Sequence:CCGGCGGCTATATTCCATACAATTACTCGAGTAATTGTATGGAATATAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020752
GPR158 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 158
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020752.1-3743s1c1
Sequence:CCGGCGGATTGGATATGAGACAGAACTCGAGTTCTGTCTCATATCCAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020752.1-1053s1c1
Sequence:CCGGCCTCAACAATTCAGAGTGTATCTCGAGATACACTCTGAATTGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020752.1-1485s1c1
Sequence:CCGGGCCAAGCACATTTCGCTGTATCTCGAGATACAGCGAAATGTGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020752.1-3253s1c1
Sequence:CCGGCGCATAGATAAGGCTGAAGTACTCGAGTACTTCAGCCTTATCTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020752.1-2967s1c1
Sequence:CCGGGCCTCAGAAATCTGGGATTATCTCGAGATAATCCCAGATTTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020752.2-4146s21c1
Sequence:CCGGTTGATAGCACTGCTAACTTAACTCGAGTTAAGTTAGCAGTGCTATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020752.2-1486s21c1
Sequence:CCGGCCAAGCACATTTCGCTGTATTCTCGAGAATACAGCGAAATGTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020752.2-2144s21c1
Sequence:CCGGACCTGAACAGCAGTATCAATTCTCGAGAATTGATACTGCTGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020752
GPR158 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 158
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020752.1-3743s1c1
Sequence:CCGGCGGATTGGATATGAGACAGAACTCGAGTTCTGTCTCATATCCAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020752.1-1053s1c1
Sequence:CCGGCCTCAACAATTCAGAGTGTATCTCGAGATACACTCTGAATTGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020752.1-1485s1c1
Sequence:CCGGGCCAAGCACATTTCGCTGTATCTCGAGATACAGCGAAATGTGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020752.1-3253s1c1
Sequence:CCGGCGCATAGATAAGGCTGAAGTACTCGAGTACTTCAGCCTTATCTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020752.1-2967s1c1
Sequence:CCGGGCCTCAGAAATCTGGGATTATCTCGAGATAATCCCAGATTTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020752.2-4146s21c1
Sequence:CCGGTTGATAGCACTGCTAACTTAACTCGAGTTAAGTTAGCAGTGCTATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020752.2-1486s21c1
Sequence:CCGGCCAAGCACATTTCGCTGTATTCTCGAGAATACAGCGAAATGTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020752.2-2144s21c1
Sequence:CCGGACCTGAACAGCAGTATCAATTCTCGAGAATTGATACTGCTGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020752
GPR158 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 158
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020752.1-3743s1c1
Sequence:CCGGCGGATTGGATATGAGACAGAACTCGAGTTCTGTCTCATATCCAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020752.1-1053s1c1
Sequence:CCGGCCTCAACAATTCAGAGTGTATCTCGAGATACACTCTGAATTGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020752.1-1485s1c1
Sequence:CCGGGCCAAGCACATTTCGCTGTATCTCGAGATACAGCGAAATGTGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020752.1-3253s1c1
Sequence:CCGGCGCATAGATAAGGCTGAAGTACTCGAGTACTTCAGCCTTATCTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020752.1-2967s1c1
Sequence:CCGGGCCTCAGAAATCTGGGATTATCTCGAGATAATCCCAGATTTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020752.2-4146s21c1
Sequence:CCGGTTGATAGCACTGCTAACTTAACTCGAGTTAAGTTAGCAGTGCTATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020752.2-1486s21c1
Sequence:CCGGCCAAGCACATTTCGCTGTATTCTCGAGAATACAGCGAAATGTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020752.2-2144s21c1
Sequence:CCGGACCTGAACAGCAGTATCAATTCTCGAGAATTGATACTGCTGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks