EMAIL THIS PAGE TO A FRIEND

GPR15

G protein-coupled receptor 15

66 Gene Product Result for
Synonyms: BOB
UniProtKB ID: P49685, Q3MIL4, Q6ISN6
Gene ID:
Human(2838) Summary: This gene encodes a G protein-coupled receptor that acts as a chemokine receptor for human immunodeficiency virus type 1 and 2. The encoded protein localizes to the cell membrane. [provided by RefSeq, Nov 2012]
Mouse(71223) G protein-coupled receptor 15
Rat(288181) G protein-coupled receptor 15
chicken(427956) G protein-coupled receptor 15
cow(538740) G protein-coupled receptor 15
domestic cat(101091302) G protein-coupled receptor 15
dog(487947) G protein-coupled receptor 15
sheep(101106559) G protein-coupled receptor 15
domestic guinea pig(100720613) G protein-coupled receptor 15
naked mole-rat(101704263) G protein-coupled receptor 15
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005290 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005290 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005290 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_156321 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_156321 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_156321 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150971 MISSION® esiRNA esiRNA human GPR15 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005290 Rosetta Predictions human pricing
NM_001105890 Rosetta Predictions rat pricing
XM_156321 Rosetta Predictions mouse pricing
XM_916786 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005290 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126634 predicted 322
2 SASI_Hs01_00126635 predicted 322
3 SASI_Hs01_00126636 predicted 853
4 SASI_Hs01_00126637 predicted 521
5 SASI_Hs01_00126638 predicted 560
6 SASI_Hs01_00126639 predicted 401
7 SASI_Hs01_00126640 predicted 819
8 SASI_Hs01_00126641 predicted 814
9 SASI_Hs01_00126642 predicted 666
10 SASI_Hs01_00126643 predicted 760
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105890 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213542 predicted 708
2 SASI_Rn02_00213543 predicted 767
3 SASI_Rn02_00213544 predicted 897
4 SASI_Rn02_00213545 predicted 694
5 SASI_Rn02_00213546 predicted 552
6 SASI_Rn02_00213547 predicted 470
7 SASI_Rn02_00213548 predicted 335
8 SASI_Rn02_00213549 predicted 412
9 SASI_Rn02_00213550 predicted 795
10 SASI_Rn02_00213551 predicted 478
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_156321 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00239109 predicted 1410
2 SASI_Mm02_00425426 predicted 497
3 SASI_Mm02_00425427 predicted 366
4 SASI_Mm02_00425428 predicted 669
5 SASI_Mm02_00425429 predicted 862
6 SASI_Mm02_00425430 predicted 433
7 SASI_Mm02_00425431 predicted 1176
8 SASI_Mm01_00239113 predicted 1346
9 SASI_Mm02_00425432 predicted 486
10 SASI_Mm02_00425433 predicted 536
11 SASI_Mm01_00239110 predicted 1353
12 SASI_Mm01_00239111 predicted 1102
13 SASI_Mm01_00239112 predicted 1123
14 SASI_Mm01_00239114 predicted 1254
15 SASI_Mm01_00239115 predicted 1057
16 SASI_Mm01_00239116 predicted 1282
17 SASI_Mm01_00239117 predicted 1147
18 SASI_Mm01_00239118 predicted 1238
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_916786 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00440630 predicted 1411
2 SASI_Mm02_00440631 predicted 501
3 SASI_Mm02_00440632 predicted 367
4 SASI_Mm02_00440633 predicted 667
5 SASI_Mm02_00440634 predicted 866
6 SASI_Mm02_00440635 predicted 440
7 SASI_Mm02_00440636 predicted 1349
8 SASI_Mm02_00440637 predicted 496
9 SASI_Mm02_00440638 predicted 534
10 SASI_Mm02_00440639 predicted 605
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005290
GPR15 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 15
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005290.1-765s1c1
Sequence:CCGGGCCCTTCAATACTTTCAAGTTCTCGAGAACTTGAAAGTATTGAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005290.1-562s1c1
Sequence:CCGGGCAACTCCAATTAAACTCATACTCGAGTATGAGTTTAATTGGAGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005290.1-826s1c1
Sequence:CCGGCCCTCAGCTATTCTTCAGCTTCTCGAGAAGCTGAAGAATAGCTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005290.1-193s1c1
Sequence:CCGGCGAAGACTGATCGACATCTTTCTCGAGAAAGATGTCGATCAGTCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005290.1-84s1c1
Sequence:CCGGTGTTCCTTACACCTCTGTCTTCTCGAGAAGACAGAGGTGTAAGGAACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005290.1-583s21c1
Sequence:CCGGTGGTCCCTGGTGGCCTTAATTCTCGAGAATTAAGGCCACCAGGGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005290.1-805s21c1
Sequence:CCGGTTGCGGCAAGAACACTATTTACTCGAGTAAATAGTGTTCTTGCCGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005290.1-329s21c1
Sequence:CCGGCCTACATGATCTCCGTCAATACTCGAGTATTGACGGAGATCATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005290.1-159s21c1
Sequence:CCGGTCTCATGGGAGCGTTGCATTTCTCGAGAAATGCAACGCTCCCATGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005290
GPR15 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 15
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005290.1-765s1c1
Sequence:CCGGGCCCTTCAATACTTTCAAGTTCTCGAGAACTTGAAAGTATTGAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005290.1-562s1c1
Sequence:CCGGGCAACTCCAATTAAACTCATACTCGAGTATGAGTTTAATTGGAGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005290.1-826s1c1
Sequence:CCGGCCCTCAGCTATTCTTCAGCTTCTCGAGAAGCTGAAGAATAGCTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005290.1-193s1c1
Sequence:CCGGCGAAGACTGATCGACATCTTTCTCGAGAAAGATGTCGATCAGTCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005290.1-84s1c1
Sequence:CCGGTGTTCCTTACACCTCTGTCTTCTCGAGAAGACAGAGGTGTAAGGAACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005290.1-583s21c1
Sequence:CCGGTGGTCCCTGGTGGCCTTAATTCTCGAGAATTAAGGCCACCAGGGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005290.1-805s21c1
Sequence:CCGGTTGCGGCAAGAACACTATTTACTCGAGTAAATAGTGTTCTTGCCGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005290.1-329s21c1
Sequence:CCGGCCTACATGATCTCCGTCAATACTCGAGTATTGACGGAGATCATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005290.1-159s21c1
Sequence:CCGGTCTCATGGGAGCGTTGCATTTCTCGAGAAATGCAACGCTCCCATGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005290
GPR15 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 15
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005290.1-765s1c1
Sequence:CCGGGCCCTTCAATACTTTCAAGTTCTCGAGAACTTGAAAGTATTGAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005290.1-562s1c1
Sequence:CCGGGCAACTCCAATTAAACTCATACTCGAGTATGAGTTTAATTGGAGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005290.1-826s1c1
Sequence:CCGGCCCTCAGCTATTCTTCAGCTTCTCGAGAAGCTGAAGAATAGCTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005290.1-193s1c1
Sequence:CCGGCGAAGACTGATCGACATCTTTCTCGAGAAAGATGTCGATCAGTCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005290.1-84s1c1
Sequence:CCGGTGTTCCTTACACCTCTGTCTTCTCGAGAAGACAGAGGTGTAAGGAACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005290.1-583s21c1
Sequence:CCGGTGGTCCCTGGTGGCCTTAATTCTCGAGAATTAAGGCCACCAGGGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005290.1-805s21c1
Sequence:CCGGTTGCGGCAAGAACACTATTTACTCGAGTAAATAGTGTTCTTGCCGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005290.1-329s21c1
Sequence:CCGGCCTACATGATCTCCGTCAATACTCGAGTATTGACGGAGATCATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005290.1-159s21c1
Sequence:CCGGTCTCATGGGAGCGTTGCATTTCTCGAGAAATGCAACGCTCCCATGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_156321
GPR15 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 15
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000226059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_156321.5-901s21c1
Sequence:CCGGGAAGAAACCCACGTCCTTAAACTCGAGTTTAAGGACGTGGGTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_156321.5-1059s21c1
Sequence:CCGGAGTCCATAAAGATCGTTATTACTCGAGTAATAACGATCTTTATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_156321.5-1236s21c1
Sequence:GTACCGGTCAACCCTCTCATTTACTATGCTCGAGCATAGTAAATGAGAGGGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_156321.5-1447s21c1
Sequence:CCGGCAAGCTCTGTTGGCACTCTTTCTCGAGAAAGAGTGCCAACAGAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_156321.5-1004s21c1
Sequence:CCGGAGGAGGCTGTGTGCTCATTACCTCGAGGTAATGAGCACACAGCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_156321
GPR15 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 15
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000226059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_156321.5-901s21c1
Sequence:CCGGGAAGAAACCCACGTCCTTAAACTCGAGTTTAAGGACGTGGGTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_156321.5-1059s21c1
Sequence:CCGGAGTCCATAAAGATCGTTATTACTCGAGTAATAACGATCTTTATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_156321.5-1236s21c1
Sequence:GTACCGGTCAACCCTCTCATTTACTATGCTCGAGCATAGTAAATGAGAGGGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_156321.5-1447s21c1
Sequence:CCGGCAAGCTCTGTTGGCACTCTTTCTCGAGAAAGAGTGCCAACAGAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_156321.5-1004s21c1
Sequence:CCGGAGGAGGCTGTGTGCTCATTACCTCGAGGTAATGAGCACACAGCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_156321
GPR15 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 15
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000226059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_156321.5-901s21c1
Sequence:CCGGGAAGAAACCCACGTCCTTAAACTCGAGTTTAAGGACGTGGGTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_156321.5-1059s21c1
Sequence:CCGGAGTCCATAAAGATCGTTATTACTCGAGTAATAACGATCTTTATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_156321.5-1236s21c1
Sequence:GTACCGGTCAACCCTCTCATTTACTATGCTCGAGCATAGTAAATGAGAGGGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_156321.5-1447s21c1
Sequence:CCGGCAAGCTCTGTTGGCACTCTTTCTCGAGAAAGAGTGCCAACAGAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_156321.5-1004s21c1
Sequence:CCGGAGGAGGCTGTGTGCTCATTACCTCGAGGTAATGAGCACACAGCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks