EMAIL THIS PAGE TO A FRIEND

GPR160

G protein-coupled receptor 160

119 Gene Product Result for
Synonyms: GPCR1 GPCR150
UniProtKB ID: Q9UJ42, D3DNQ2
Gene ID:
Mouse(71862) G protein-coupled receptor 160
Rat(499588) G protein-coupled receptor 160
Zebrafish(100007673) G protein-coupled receptor 160
cow(784906) G protein-coupled receptor 160
domestic cat(101087515) G protein-coupled receptor 160
dog(100685878) G protein-coupled receptor 160
chicken(424992) G protein-coupled receptor 160
domestic guinea pig(100730598) G protein-coupled receptor 160
naked mole-rat(101723264) G protein-coupled receptor 160
sheep(101119099) G protein-coupled receptor 160
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014373 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014373 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014373 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_130823 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_130823 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_130823 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014373 Rosetta Predictions human pricing
NM_001025147 Rosetta Predictions rat pricing
XM_130823 Rosetta Predictions mouse pricing
XM_896590 Rosetta Predictions mouse pricing
XM_921004 Rosetta Predictions mouse pricing
XM_921012 Rosetta Predictions mouse pricing
XM_977547 Rosetta Predictions mouse pricing
XM_980080 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014373 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108103 predicted 1009
2 SASI_Hs01_00108104 predicted 926
3 SASI_Hs01_00108105 predicted 1231
4 SASI_Hs01_00108106 predicted 1306
5 SASI_Hs01_00108107 predicted 386
6 SASI_Hs01_00108108 predicted 1236
7 SASI_Hs02_00345525 predicted 1129
8 SASI_Hs01_00108109 predicted 1069
9 SASI_Hs01_00108110 predicted 1194
10 SASI_Hs01_00108111 predicted 1379
11 SASI_Hs01_00108112 predicted 1122
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025147 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108944 predicted 476
2 SASI_Rn01_00108945 predicted 460
3 SASI_Rn01_00108946 predicted 456
4 SASI_Rn01_00108947 predicted 803
5 SASI_Rn01_00108948 predicted 487
6 SASI_Rn01_00108949 predicted 1081
7 SASI_Rn01_00108950 predicted 442
8 SASI_Rn01_00108951 predicted 543
9 SASI_Rn01_00108952 predicted 1088
10 SASI_Rn01_00108953 predicted 651
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_130823 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00424385 predicted 711
2 SASI_Mm02_00424386 predicted 704
3 SASI_Mm01_00207815 predicted 1151
4 SASI_Mm02_00424387 predicted 580
5 SASI_Mm02_00424388 predicted 708
6 SASI_Mm02_00424389 predicted 704
7 SASI_Mm02_00424390 predicted 706
8 SASI_Mm02_00424391 predicted 627
9 SASI_Mm02_00424392 predicted 636
10 SASI_Mm02_00424393 predicted 583
11 SASI_Mm01_00207810 predicted 1408
12 SASI_Mm01_00207811 predicted 841
13 SASI_Mm01_00207812 predicted 853
14 SASI_Mm01_00207813 predicted 1233
15 SASI_Mm01_00207814 predicted 1371
16 SASI_Mm01_00207816 predicted 1356
17 SASI_Mm01_00207817 predicted 835
18 SASI_Mm01_00207818 predicted 1473
19 SASI_Mm01_00207819 predicted 863
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896590 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00274978 predicted 1069
2 SASI_Mm01_00274980 predicted 519
3 SASI_Mm01_00274981 predicted 897
4 SASI_Mm01_00274982 predicted 1038
5 SASI_Mm01_00274983 predicted 868
6 SASI_Mm01_00274984 predicted 1028
7 SASI_Mm01_00274985 predicted 502
8 SASI_Mm01_00274987 predicted 529
9 SASI_Mm02_00429750 predicted 881
10 SASI_Mm02_00429751 predicted 659
11 SASI_Mm01_00274979 predicted 509
12 SASI_Mm01_00274986 predicted 1143
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_921004 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00442908 predicted 1070
2 SASI_Mm02_00442909 predicted 516
3 SASI_Mm02_00442910 predicted 904
4 SASI_Mm02_00442911 predicted 1040
5 SASI_Mm02_00442912 predicted 867
6 SASI_Mm02_00442913 predicted 1024
7 SASI_Mm02_00442914 predicted 503
8 SASI_Mm02_00442915 predicted 532
9 SASI_Mm02_00442916 predicted 874
10 SASI_Mm02_00442917 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_921012 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00442918 predicted 1363
2 SASI_Mm02_00442919 predicted 801
3 SASI_Mm02_00442920 predicted 1192
4 SASI_Mm02_00442921 predicted 1329
5 SASI_Mm02_00442922 predicted 1153
6 SASI_Mm02_00442923 predicted 1316
7 SASI_Mm02_00442924 predicted 789
8 SASI_Mm02_00442925 predicted 820
9 SASI_Mm02_00442926 predicted 1172
10 SASI_Mm02_00442927 predicted 948
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_977547 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00446348 predicted 1096
2 SASI_Mm02_00446349 predicted 1099
3 SASI_Mm01_00233494 predicted 1548
4 SASI_Mm02_00446350 predicted 974
5 SASI_Mm02_00446351 predicted 1099
6 SASI_Mm02_00446352 predicted 1090
7 SASI_Mm02_00446353 predicted 1090
8 SASI_Mm02_00446354 predicted 1015
9 SASI_Mm02_00446355 predicted 1023
10 SASI_Mm02_00446356 predicted 975
11 SASI_Mm01_00233489 predicted 1757
12 SASI_Mm01_00233490 predicted 1190
13 SASI_Mm01_00233491 predicted 1200
14 SASI_Mm01_00233492 predicted 1581
15 SASI_Mm01_00233493 predicted 1730
16 SASI_Mm01_00233495 predicted 1707
17 SASI_Mm01_00233496 predicted 1185
18 SASI_Mm01_00233497 predicted 1825
19 SASI_Mm01_00233498 predicted 1216
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_980080 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00447140 predicted 1750
2 SASI_Mm02_00447141 predicted 1192
3 SASI_Mm02_00447142 predicted 1584
4 SASI_Mm02_00447143 predicted 1720
5 SASI_Mm02_00447144 predicted 1542
6 SASI_Mm02_00447145 predicted 1700
7 SASI_Mm02_00447146 predicted 1178
8 SASI_Mm02_00447147 predicted 1208
9 SASI_Mm02_00447148 predicted 1557
10 SASI_Mm02_00447149 predicted 1341
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014373
GPR160 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 160
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014373.2-1746s21c1
Sequence:CCGGGGGCTATGATACCAGTTATTACTCGAGTAATAACTGGTATCATAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014373.2-1281s21c1
Sequence:CCGGAGTTATACTGTGAGATCTAAACTCGAGTTTAGATCTCACAGTATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014373.2-843s21c1
Sequence:CCGGTTAAGCATTAGGTTCACTAAACTCGAGTTTAGTGAACCTAATGCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014373.1-1186s1c1
Sequence:CCGGGCTACAGTGTATTGGTTTAATCTCGAGATTAAACCAATACACTGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014373.1-949s1c1
Sequence:CCGGGCTATCAGGATAACTTCCTATCTCGAGATAGGAAGTTATCCTGATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014373.1-1154s1c1
Sequence:CCGGCCTGGTTATACTTTGTCAATACTCGAGTATTGACAAAGTATAACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014373.1-1279s1c1
Sequence:CCGGCCACTTACAATTCCTAATCTTCTCGAGAAGATTAGGAATTGTAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014373.1-1474s1c1
Sequence:CCGGGAAGGGCTATACCAGTTATTACTCGAGTAATAACTGGTATAGCCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014373
GPR160 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 160
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014373.2-1746s21c1
Sequence:CCGGGGGCTATGATACCAGTTATTACTCGAGTAATAACTGGTATCATAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014373.2-1281s21c1
Sequence:CCGGAGTTATACTGTGAGATCTAAACTCGAGTTTAGATCTCACAGTATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014373.2-843s21c1
Sequence:CCGGTTAAGCATTAGGTTCACTAAACTCGAGTTTAGTGAACCTAATGCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014373.1-1186s1c1
Sequence:CCGGGCTACAGTGTATTGGTTTAATCTCGAGATTAAACCAATACACTGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014373.1-949s1c1
Sequence:CCGGGCTATCAGGATAACTTCCTATCTCGAGATAGGAAGTTATCCTGATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014373.1-1154s1c1
Sequence:CCGGCCTGGTTATACTTTGTCAATACTCGAGTATTGACAAAGTATAACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014373.1-1279s1c1
Sequence:CCGGCCACTTACAATTCCTAATCTTCTCGAGAAGATTAGGAATTGTAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014373.1-1474s1c1
Sequence:CCGGGAAGGGCTATACCAGTTATTACTCGAGTAATAACTGGTATAGCCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014373
GPR160 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 160
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014373.2-1746s21c1
Sequence:CCGGGGGCTATGATACCAGTTATTACTCGAGTAATAACTGGTATCATAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014373.2-1281s21c1
Sequence:CCGGAGTTATACTGTGAGATCTAAACTCGAGTTTAGATCTCACAGTATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014373.2-843s21c1
Sequence:CCGGTTAAGCATTAGGTTCACTAAACTCGAGTTTAGTGAACCTAATGCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014373.1-1186s1c1
Sequence:CCGGGCTACAGTGTATTGGTTTAATCTCGAGATTAAACCAATACACTGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014373.1-949s1c1
Sequence:CCGGGCTATCAGGATAACTTCCTATCTCGAGATAGGAAGTTATCCTGATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014373.1-1154s1c1
Sequence:CCGGCCTGGTTATACTTTGTCAATACTCGAGTATTGACAAAGTATAACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014373.1-1279s1c1
Sequence:CCGGCCACTTACAATTCCTAATCTTCTCGAGAAGATTAGGAATTGTAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014373.1-1474s1c1
Sequence:CCGGGAAGGGCTATACCAGTTATTACTCGAGTAATAACTGGTATAGCCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_130823
GPR160 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 160
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219420    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_130823.7-1741s1c1
Sequence:CCGGTATGCCTGCTCGACAACATTGCTCGAGCAATGTTGTCGAGCAGGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_130823.7-963s1c1
Sequence:CCGGTAGGTGGCAGAAATTACTTTACTCGAGTAAAGTAATTTCTGCCACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219427    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_130823.7-721s1c1
Sequence:CCGGTGGACTTTGATGGAGTACTTCCTCGAGGAAGTACTCCATCAAAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219426    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_130823.7-1452s1c1
Sequence:CCGGCTGCCACAAGCTTGATTTAAGCTCGAGCTTAAATCAAGCTTGTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_130823.7-1480s1c1
Sequence:CCGGTCGTTACCTGTGGATCCTTTCCTCGAGGAAAGGATCCACAGGTAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_130823.7-762s1c1
Sequence:CCGGCGATCTCCTGCTGTTGGTAAACTCGAGTTTACCAACAGCAGGAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_130823.7-916s1c1
Sequence:CCGGTGTATAGACTACTGGTGTAATCTCGAGATTACACCAGTAGTCTATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219421    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_130823.7-1521s1c1
Sequence:CCGGTGTTCCAGTCCATAGACTTAACTCGAGTTAAGTCTATGGACTGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_130823.7-1197s1c1
Sequence:CCGGTATGAGGATAGCATCCTATAACTCGAGTTATAGGATGCTATCCTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219418    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_130823.7-1705s1c1
Sequence:CCGGAGTAGTGCTGAGGATACATTACTCGAGTAATGTATCCTCAGCACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130823.3-1586s1c1
Sequence:CCGGCCATGTCCATAGTCATCTGTTCTCGAGAACAGATGACTATGGACATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130823.3-1149s1c1
Sequence:CCGGGCTCTCACTGTCTATGCTGATCTCGAGATCAGCATAGACAGTGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130823.3-885s1c1
Sequence:CCGGGCTCACACAAATTATTTCCTTCTCGAGAAGGAAATAATTTGTGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130823.3-823s1c1
Sequence:CCGGCTGACCTACTTCAGGGACTTTCTCGAGAAAGTCCCTGAAGTAGGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130823.3-1461s1c1
Sequence:CCGGCGCTGCAGTTTATTGGTTTAACTCGAGTTAAACCAATAAACTGCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_130823
GPR160 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 160
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219420    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_130823.7-1741s1c1
Sequence:CCGGTATGCCTGCTCGACAACATTGCTCGAGCAATGTTGTCGAGCAGGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_130823.7-963s1c1
Sequence:CCGGTAGGTGGCAGAAATTACTTTACTCGAGTAAAGTAATTTCTGCCACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219427    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_130823.7-721s1c1
Sequence:CCGGTGGACTTTGATGGAGTACTTCCTCGAGGAAGTACTCCATCAAAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219426    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_130823.7-1452s1c1
Sequence:CCGGCTGCCACAAGCTTGATTTAAGCTCGAGCTTAAATCAAGCTTGTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_130823.7-1480s1c1
Sequence:CCGGTCGTTACCTGTGGATCCTTTCCTCGAGGAAAGGATCCACAGGTAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_130823.7-762s1c1
Sequence:CCGGCGATCTCCTGCTGTTGGTAAACTCGAGTTTACCAACAGCAGGAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_130823.7-916s1c1
Sequence:CCGGTGTATAGACTACTGGTGTAATCTCGAGATTACACCAGTAGTCTATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219421    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_130823.7-1521s1c1
Sequence:CCGGTGTTCCAGTCCATAGACTTAACTCGAGTTAAGTCTATGGACTGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_130823.7-1197s1c1
Sequence:CCGGTATGAGGATAGCATCCTATAACTCGAGTTATAGGATGCTATCCTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219418    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_130823.7-1705s1c1
Sequence:CCGGAGTAGTGCTGAGGATACATTACTCGAGTAATGTATCCTCAGCACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130823.3-1586s1c1
Sequence:CCGGCCATGTCCATAGTCATCTGTTCTCGAGAACAGATGACTATGGACATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130823.3-1149s1c1
Sequence:CCGGGCTCTCACTGTCTATGCTGATCTCGAGATCAGCATAGACAGTGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130823.3-885s1c1
Sequence:CCGGGCTCACACAAATTATTTCCTTCTCGAGAAGGAAATAATTTGTGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130823.3-823s1c1
Sequence:CCGGCTGACCTACTTCAGGGACTTTCTCGAGAAAGTCCCTGAAGTAGGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130823.3-1461s1c1
Sequence:CCGGCGCTGCAGTTTATTGGTTTAACTCGAGTTAAACCAATAAACTGCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_130823
GPR160 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 160
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219420    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_130823.7-1741s1c1
Sequence:CCGGTATGCCTGCTCGACAACATTGCTCGAGCAATGTTGTCGAGCAGGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_130823.7-963s1c1
Sequence:CCGGTAGGTGGCAGAAATTACTTTACTCGAGTAAAGTAATTTCTGCCACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219427    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_130823.7-721s1c1
Sequence:CCGGTGGACTTTGATGGAGTACTTCCTCGAGGAAGTACTCCATCAAAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219426    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_130823.7-1452s1c1
Sequence:CCGGCTGCCACAAGCTTGATTTAAGCTCGAGCTTAAATCAAGCTTGTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_130823.7-1480s1c1
Sequence:CCGGTCGTTACCTGTGGATCCTTTCCTCGAGGAAAGGATCCACAGGTAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_130823.7-762s1c1
Sequence:CCGGCGATCTCCTGCTGTTGGTAAACTCGAGTTTACCAACAGCAGGAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_130823.7-916s1c1
Sequence:CCGGTGTATAGACTACTGGTGTAATCTCGAGATTACACCAGTAGTCTATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219421    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_130823.7-1521s1c1
Sequence:CCGGTGTTCCAGTCCATAGACTTAACTCGAGTTAAGTCTATGGACTGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_130823.7-1197s1c1
Sequence:CCGGTATGAGGATAGCATCCTATAACTCGAGTTATAGGATGCTATCCTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219418    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_130823.7-1705s1c1
Sequence:CCGGAGTAGTGCTGAGGATACATTACTCGAGTAATGTATCCTCAGCACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130823.3-1586s1c1
Sequence:CCGGCCATGTCCATAGTCATCTGTTCTCGAGAACAGATGACTATGGACATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130823.3-1149s1c1
Sequence:CCGGGCTCTCACTGTCTATGCTGATCTCGAGATCAGCATAGACAGTGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130823.3-885s1c1
Sequence:CCGGGCTCACACAAATTATTTCCTTCTCGAGAAGGAAATAATTTGTGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130823.3-823s1c1
Sequence:CCGGCTGACCTACTTCAGGGACTTTCTCGAGAAAGTCCCTGAAGTAGGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130823.3-1461s1c1
Sequence:CCGGCGCTGCAGTTTATTGGTTTAACTCGAGTTAAACCAATAAACTGCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks