EMAIL THIS PAGE TO A FRIEND

GPR161

G protein-coupled receptor 161

109 Gene Product Result for
Synonyms: RE2
Gene ID:
Human(23432) Summary: Upon ligand binding, G protein-coupled receptors, such as GPR161, activate cytoplasmic G proteins (see GNAS, MIM 139320), allowing the receptors to transduce extracellular signals across the plasma membrane into the cell. Phosphorylation of the receptor attenuates signaling (Matteson et al., 2008 [PubMed 18250320]
Mouse(240888) G protein-coupled receptor 161
Rat(289180) G protein-coupled receptor 161
Domestic Rabbit(100349764) G protein-coupled receptor 161
domestic guinea pig(100713924) G protein-coupled receptor 161
naked mole-rat(101697824) G protein-coupled receptor 161
Zebrafish(368421) G protein-coupled receptor 161
cow(768006) G protein-coupled receptor 161
Horse(100051574) G protein-coupled receptor 161
domestic cat(101100357) G protein-coupled receptor 161
dog(490358) G protein-coupled receptor 161
chicken(418375) G protein-coupled receptor 161
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007369 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007369 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007369 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153832 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153832 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153832 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081126 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081126 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081126 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007369 Rosetta Predictions human pricing
NM_153832 Rosetta Predictions human pricing
XM_001075481 Rosetta Predictions rat pricing
XM_222837 Rosetta Predictions rat pricing
NM_001081126 Rosetta Predictions mouse pricing
XM_136361 Rosetta Predictions mouse pricing
XM_887255 Rosetta Predictions mouse pricing
XM_897340 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007369 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074663 predicted 486
2 SASI_Hs01_00074664 predicted 329
3 SASI_Hs01_00074665 predicted 437
4 SASI_Hs01_00074666 predicted 345
5 SASI_Hs01_00074667 predicted 716
6 SASI_Hs01_00074668 predicted 328
7 SASI_Hs01_00074669 predicted 823
8 SASI_Hs01_00074670 predicted 1022
9 SASI_Hs01_00074671 predicted 326
10 SASI_Hs01_00074672 predicted 616
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153832 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145533 predicted 737
2 SASI_Hs02_00367515 predicted 1718
3 SASI_Hs01_00145535 predicted 680
4 SASI_Hs02_00367516 predicted 1339
5 SASI_Hs01_00145539 predicted 1077
6 SASI_Hs01_00145540 predicted 1269
7 SASI_Hs02_00367517 predicted 1643
8 SASI_Hs02_00367518 predicted 812
9 SASI_Hs02_00367519 predicted 1536
10 SASI_Hs02_00367520 predicted 1304
11 SASI_Hs01_00145534 predicted 585
12 SASI_Hs01_00145536 predicted 603
13 SASI_Hs01_00145537 predicted 969
14 SASI_Hs01_00145538 predicted 590
15 SASI_Hs01_00145541 predicted 581
16 SASI_Hs01_00145542 predicted 878
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075481 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00349914 predicted 1363
2 SASI_Rn02_00349915 predicted 1352
3 SASI_Rn02_00349916 predicted 426
4 SASI_Rn02_00349917 predicted 1327
5 SASI_Rn02_00349918 predicted 1021
6 SASI_Rn02_00349919 predicted 356
7 SASI_Rn02_00349920 predicted 1023
8 SASI_Rn02_00349921 predicted 971
9 SASI_Rn02_00349922 predicted 1355
10 SASI_Rn02_00349923 predicted 345
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222837 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380937 predicted 1508
2 SASI_Rn02_00380938 predicted 345
3 SASI_Rn02_00380939 predicted 566
4 SASI_Rn02_00380940 predicted 1472
5 SASI_Rn02_00380941 predicted 1168
6 SASI_Rn02_00380942 predicted 517
7 SASI_Rn02_00380943 predicted 502
8 SASI_Rn02_00380944 predicted 1115
9 SASI_Rn02_00380945 predicted 500
10 SASI_Rn02_00380946 predicted 386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081126 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295441 predicted 626
2 SASI_Mm02_00295442 predicted 959
3 SASI_Mm02_00295443 predicted 341
4 SASI_Mm02_00295444 predicted 1531
5 SASI_Mm02_00295445 predicted 1224
6 SASI_Mm02_00295446 predicted 574
7 SASI_Mm02_00295447 predicted 347
8 SASI_Mm02_00295448 predicted 334
9 SASI_Mm02_00295449 predicted 454
10 SASI_Mm02_00295450 predicted 1182
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_136361 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00239869 predicted 639
2 SASI_Mm01_00239870 predicted 971
3 SASI_Mm01_00239871 predicted 350
4 SASI_Mm01_00239872 predicted 1537
5 SASI_Mm01_00239873 predicted 1229
6 SASI_Mm01_00239874 predicted 581
7 SASI_Mm01_00239875 predicted 356
8 SASI_Mm01_00239876 predicted 957
9 SASI_Mm01_00239877 predicted 345
10 SASI_Mm01_00239878 predicted 453
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_887255 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00272813 predicted 654
2 SASI_Mm01_00272814 predicted 987
3 SASI_Mm01_00272815 predicted 372
4 SASI_Mm01_00272816 predicted 1563
5 SASI_Mm01_00272817 predicted 1253
6 SASI_Mm01_00272818 predicted 599
7 SASI_Mm01_00272819 predicted 383
8 SASI_Mm01_00272820 predicted 979
9 SASI_Mm01_00272821 predicted 1778
10 SASI_Mm01_00272822 predicted 482
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897340 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00264872 predicted 589
2 SASI_Mm01_00264873 predicted 931
3 SASI_Mm01_00264874 predicted 309
4 SASI_Mm01_00264875 predicted 1496
5 SASI_Mm01_00264876 predicted 1196
6 SASI_Mm01_00264877 predicted 532
7 SASI_Mm01_00264878 predicted 316
8 SASI_Mm01_00264879 predicted 917
9 SASI_Mm01_00264880 predicted 300
10 SASI_Mm01_00264881 predicted 411
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007369
GPR161 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 161
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007369.1-1086s1c1
Sequence:CCGGCCGGTATTATCGGGAACCATTCTCGAGAATGGTTCCCGATAATACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007369.1-240s1c1
Sequence:CCGGCCTCAGCAACAAGTTCGTCTTCTCGAGAAGACGAACTTGTTGCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007369.1-1023s1c1
Sequence:CCGGCCTGATCTATGGACTCTGGAACTCGAGTTCCAGAGTCCATAGATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007369.1-157s1c1
Sequence:CCGGGCCATCATTGTCATCACCATTCTCGAGAATGGTGATGACAATGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007369.1-576s1c1
Sequence:CCGGCGAGTTCAAATGGATGTGTGTCTCGAGACACACATCCATTTGAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007369
GPR161 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 161
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007369.1-1086s1c1
Sequence:CCGGCCGGTATTATCGGGAACCATTCTCGAGAATGGTTCCCGATAATACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007369.1-240s1c1
Sequence:CCGGCCTCAGCAACAAGTTCGTCTTCTCGAGAAGACGAACTTGTTGCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007369.1-1023s1c1
Sequence:CCGGCCTGATCTATGGACTCTGGAACTCGAGTTCCAGAGTCCATAGATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007369.1-157s1c1
Sequence:CCGGGCCATCATTGTCATCACCATTCTCGAGAATGGTGATGACAATGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007369.1-576s1c1
Sequence:CCGGCGAGTTCAAATGGATGTGTGTCTCGAGACACACATCCATTTGAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007369
GPR161 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 161
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007369.1-1086s1c1
Sequence:CCGGCCGGTATTATCGGGAACCATTCTCGAGAATGGTTCCCGATAATACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007369.1-240s1c1
Sequence:CCGGCCTCAGCAACAAGTTCGTCTTCTCGAGAAGACGAACTTGTTGCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007369.1-1023s1c1
Sequence:CCGGCCTGATCTATGGACTCTGGAACTCGAGTTCCAGAGTCCATAGATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007369.1-157s1c1
Sequence:CCGGGCCATCATTGTCATCACCATTCTCGAGAATGGTGATGACAATGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007369.1-576s1c1
Sequence:CCGGCGAGTTCAAATGGATGTGTGTCTCGAGACACACATCCATTTGAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153832
GPR161 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 161
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153832.1-1341s21c1
Sequence:CCGGCGGTATTATCGGGAACCATTTCTCGAGAAATGGTTCCCGATAATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153832.1-2078s21c1
Sequence:CCGGAGTCCACAGCTTCAGCATTTCCTCGAGGAAATGCTGAAGCTGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153832.1-400s21c1
Sequence:CCGGCCCAGTTCATCGCCATCATTGCTCGAGCAATGATGGCGATGAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255427    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153832.1-2135s21c1
Sequence:CCGGATGGGACCAGAAGCATCTAAACTCGAGTTTAGATGCTTCTGGTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153832.1-580s21c1
Sequence:CCGGTCCGCAGGGAATGGATCTTTGCTCGAGCAAAGATCCATTCCCTGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153832.1-1651s21c1
Sequence:CCGGACTCGATTCTTCATGTGAAAGCTCGAGCTTTCACATGAAGAATCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153832.1-1593s21c1
Sequence:CCGGAGAAGGAGCTCGGTGACATTTCTCGAGAAATGTCACCGAGCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153832.1-808s21c1
Sequence:CCGGGTTGGTCATCCGTGGAGTTTGCTCGAGCAAACTCCACGGATGACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153832
GPR161 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 161
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153832.1-1341s21c1
Sequence:CCGGCGGTATTATCGGGAACCATTTCTCGAGAAATGGTTCCCGATAATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153832.1-2078s21c1
Sequence:CCGGAGTCCACAGCTTCAGCATTTCCTCGAGGAAATGCTGAAGCTGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153832.1-400s21c1
Sequence:CCGGCCCAGTTCATCGCCATCATTGCTCGAGCAATGATGGCGATGAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255427    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153832.1-2135s21c1
Sequence:CCGGATGGGACCAGAAGCATCTAAACTCGAGTTTAGATGCTTCTGGTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153832.1-580s21c1
Sequence:CCGGTCCGCAGGGAATGGATCTTTGCTCGAGCAAAGATCCATTCCCTGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153832.1-1651s21c1
Sequence:CCGGACTCGATTCTTCATGTGAAAGCTCGAGCTTTCACATGAAGAATCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153832.1-1593s21c1
Sequence:CCGGAGAAGGAGCTCGGTGACATTTCTCGAGAAATGTCACCGAGCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153832.1-808s21c1
Sequence:CCGGGTTGGTCATCCGTGGAGTTTGCTCGAGCAAACTCCACGGATGACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153832
GPR161 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 161
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153832.1-1341s21c1
Sequence:CCGGCGGTATTATCGGGAACCATTTCTCGAGAAATGGTTCCCGATAATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153832.1-2078s21c1
Sequence:CCGGAGTCCACAGCTTCAGCATTTCCTCGAGGAAATGCTGAAGCTGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153832.1-400s21c1
Sequence:CCGGCCCAGTTCATCGCCATCATTGCTCGAGCAATGATGGCGATGAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255427    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153832.1-2135s21c1
Sequence:CCGGATGGGACCAGAAGCATCTAAACTCGAGTTTAGATGCTTCTGGTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153832.1-580s21c1
Sequence:CCGGTCCGCAGGGAATGGATCTTTGCTCGAGCAAAGATCCATTCCCTGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153832.1-1651s21c1
Sequence:CCGGACTCGATTCTTCATGTGAAAGCTCGAGCTTTCACATGAAGAATCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153832.1-1593s21c1
Sequence:CCGGAGAAGGAGCTCGGTGACATTTCTCGAGAAATGTCACCGAGCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153832.1-808s21c1
Sequence:CCGGGTTGGTCATCCGTGGAGTTTGCTCGAGCAAACTCCACGGATGACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081126
GPR161 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 161
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081126.1-1587s21c1
Sequence:CCGGTACGCAGCCAGCTTGGCTAAACTCGAGTTTAGCCAAGCTGGCTGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081126.1-968s21c1
Sequence:CCGGCCTTCAAGGAGTGGTCTATTCCTCGAGGAATAGACCACTCCTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081126.1-1482s21c1
Sequence:CCGGAGGAGGAGCTCCGTGACATTTCTCGAGAAATGTCACGGAGCTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081126.1-754s21c1
Sequence:CCGGAGGAACCCGGCTACACCATTTCTCGAGAAATGGTGTAGCCGGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081126.1-466s21c1
Sequence:CCGGCCATCCGGAGGGAATGGATTTCTCGAGAAATCCATTCCCTCCGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081126
GPR161 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 161
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081126.1-1587s21c1
Sequence:CCGGTACGCAGCCAGCTTGGCTAAACTCGAGTTTAGCCAAGCTGGCTGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081126.1-968s21c1
Sequence:CCGGCCTTCAAGGAGTGGTCTATTCCTCGAGGAATAGACCACTCCTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081126.1-1482s21c1
Sequence:CCGGAGGAGGAGCTCCGTGACATTTCTCGAGAAATGTCACGGAGCTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081126.1-754s21c1
Sequence:CCGGAGGAACCCGGCTACACCATTTCTCGAGAAATGGTGTAGCCGGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081126.1-466s21c1
Sequence:CCGGCCATCCGGAGGGAATGGATTTCTCGAGAAATCCATTCCCTCCGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081126
GPR161 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 161
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081126.1-1587s21c1
Sequence:CCGGTACGCAGCCAGCTTGGCTAAACTCGAGTTTAGCCAAGCTGGCTGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081126.1-968s21c1
Sequence:CCGGCCTTCAAGGAGTGGTCTATTCCTCGAGGAATAGACCACTCCTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081126.1-1482s21c1
Sequence:CCGGAGGAGGAGCTCCGTGACATTTCTCGAGAAATGTCACGGAGCTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081126.1-754s21c1
Sequence:CCGGAGGAACCCGGCTACACCATTTCTCGAGAAATGGTGTAGCCGGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081126.1-466s21c1
Sequence:CCGGCCATCCGGAGGGAATGGATTTCTCGAGAAATCCATTCCCTCCGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks