EMAIL THIS PAGE TO A FRIEND

GPR162

G protein-coupled receptor 162

Synonyms: A-2 GRCA
UniProtKB ID: Q16538, Q16664, Q59EH5, Q66K56
Gene ID:
Human(27239) Summary: This gene was identified upon genomic analysis of a gene-dense region at human chromosome 12p13. It appears to be mainly expressed in the brain; however, its function is not known. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(14788) G protein-coupled receptor 162
Rat(362436) G protein-coupled receptor 162
chicken(418288) G protein-coupled receptor 162
cow(540410) G protein-coupled receptor 162
Horse(100146294) G protein-coupled receptor 162
domestic cat(101084547) G protein-coupled receptor 162
dog(486719) G protein-coupled receptor 162
domestic guinea pig(101789188) G protein-coupled receptor 162
naked mole-rat(101717869) G protein-coupled receptor 162
sheep(101109088) G protein-coupled receptor 162
Domestic Rabbit(100345332) G protein-coupled receptor 162
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019858 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019858 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019858 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013533 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013533 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013533 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU038941 MISSION® esiRNA esiRNA targeting mouse Gpr162 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014449 Rosetta Predictions human pricing
NM_019858 Rosetta Predictions human pricing
NM_001108646 Rosetta Predictions rat pricing
NM_013533 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014449 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151689 predicted 1041
2 SASI_Hs01_00151690 predicted 762
3 SASI_Hs01_00151691 predicted 714
4 SASI_Hs01_00151693 predicted 615
5 SASI_Hs01_00151694 predicted 774
6 SASI_Hs01_00151695 predicted 906
7 SASI_Hs01_00151696 predicted 818
8 SASI_Hs01_00151697 predicted 718
9 SASI_Hs01_00151698 predicted 717
10 SASI_Hs02_00345661 predicted 1047
11 SASI_Hs01_00151692 predicted 1025
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019858 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151178 predicted 2051
2 SASI_Hs01_00151179 predicted 1763
3 SASI_Hs01_00151180 predicted 1713
4 SASI_Hs01_00151182 predicted 1619
5 SASI_Hs01_00151183 predicted 1773
6 SASI_Hs01_00151184 predicted 1903
7 SASI_Hs01_00151185 predicted 1820
8 SASI_Hs01_00151186 predicted 1720
9 SASI_Hs01_00151187 predicted 1722
10 SASI_Hs02_00352886 predicted 2053
11 SASI_Hs01_00151181 predicted 2028
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108646 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240679 predicted 1078
2 SASI_Rn02_00240680 predicted 1904
3 SASI_Rn02_00240681 predicted 1170
4 SASI_Rn02_00240682 predicted 2527
5 SASI_Rn02_00240683 predicted 1488
6 SASI_Rn02_00240684 predicted 1539
7 SASI_Rn02_00240685 predicted 2595
8 SASI_Rn02_00240686 predicted 2539
9 SASI_Rn02_00240687 predicted 2307
10 SASI_Rn02_00240688 predicted 2086
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013533 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043541 predicted 2105
2 SASI_Mm01_00043542 predicted 1759
3 SASI_Mm01_00043543 predicted 1718
4 SASI_Mm02_00322229 predicted 2193
5 SASI_Mm01_00043544 predicted 713
6 SASI_Mm01_00043545 predicted 1894
7 SASI_Mm01_00043546 predicted 833
8 SASI_Mm01_00043547 predicted 1732
9 SASI_Mm01_00043548 predicted 1669
10 SASI_Mm01_00043550 predicted 835
11 SASI_Mm01_00043549 predicted 1694
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019858
GPR162 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 162
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019858.1-1728s21c1
Sequence:CCGGTTGAGAGAGTCCACTACTTACCTCGAGGTAAGTAGTGGACTCTCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019858.1-2179s21c1
Sequence:CCGGTGGACTTCCTTTGGGACTAAGCTCGAGCTTAGTCCCAAAGGAAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019858.1-1769s21c1
Sequence:CCGGCTGTCCCATGATGAGACAAACCTCGAGGTTTGTCTCATCATGGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019858.1-782s21c1
Sequence:CCGGTATGACTGGAACGAGAGTATCCTCGAGGATACTCTCGTTCCAGTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019858.1-2339s21c1
Sequence:CCGGTGAGTGAGTAACACCTCATTCCTCGAGGAATGAGGTGTTACTCACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008997    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019858.1-2337s1c1
Sequence:CCGGCCTGAGTGAGTAACACCTCATCTCGAGATGAGGTGTTACTCACTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019858.1-1259s1c1
Sequence:CCGGCCAGCCATTGTGGTGGAGGATCTCGAGATCCTCCACCACAATGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019858.1-1727s1c1
Sequence:CCGGCTTGAGAGAGTCCACTACTTACTCGAGTAAGTAGTGGACTCTCTCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019858.1-1039s1c1
Sequence:CCGGCCAGTTCATAGTCTCCAAGATCTCGAGATCTTGGAGACTATGAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019858
GPR162 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 162
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019858.1-1728s21c1
Sequence:CCGGTTGAGAGAGTCCACTACTTACCTCGAGGTAAGTAGTGGACTCTCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019858.1-2179s21c1
Sequence:CCGGTGGACTTCCTTTGGGACTAAGCTCGAGCTTAGTCCCAAAGGAAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019858.1-1769s21c1
Sequence:CCGGCTGTCCCATGATGAGACAAACCTCGAGGTTTGTCTCATCATGGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019858.1-782s21c1
Sequence:CCGGTATGACTGGAACGAGAGTATCCTCGAGGATACTCTCGTTCCAGTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019858.1-2339s21c1
Sequence:CCGGTGAGTGAGTAACACCTCATTCCTCGAGGAATGAGGTGTTACTCACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008997    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019858.1-2337s1c1
Sequence:CCGGCCTGAGTGAGTAACACCTCATCTCGAGATGAGGTGTTACTCACTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019858.1-1259s1c1
Sequence:CCGGCCAGCCATTGTGGTGGAGGATCTCGAGATCCTCCACCACAATGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019858.1-1727s1c1
Sequence:CCGGCTTGAGAGAGTCCACTACTTACTCGAGTAAGTAGTGGACTCTCTCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019858.1-1039s1c1
Sequence:CCGGCCAGTTCATAGTCTCCAAGATCTCGAGATCTTGGAGACTATGAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019858
GPR162 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 162
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019858.1-1728s21c1
Sequence:CCGGTTGAGAGAGTCCACTACTTACCTCGAGGTAAGTAGTGGACTCTCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019858.1-2179s21c1
Sequence:CCGGTGGACTTCCTTTGGGACTAAGCTCGAGCTTAGTCCCAAAGGAAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019858.1-1769s21c1
Sequence:CCGGCTGTCCCATGATGAGACAAACCTCGAGGTTTGTCTCATCATGGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019858.1-782s21c1
Sequence:CCGGTATGACTGGAACGAGAGTATCCTCGAGGATACTCTCGTTCCAGTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019858.1-2339s21c1
Sequence:CCGGTGAGTGAGTAACACCTCATTCCTCGAGGAATGAGGTGTTACTCACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008997    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019858.1-2337s1c1
Sequence:CCGGCCTGAGTGAGTAACACCTCATCTCGAGATGAGGTGTTACTCACTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019858.1-1259s1c1
Sequence:CCGGCCAGCCATTGTGGTGGAGGATCTCGAGATCCTCCACCACAATGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019858.1-1727s1c1
Sequence:CCGGCTTGAGAGAGTCCACTACTTACTCGAGTAAGTAGTGGACTCTCTCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019858.1-1039s1c1
Sequence:CCGGCCAGTTCATAGTCTCCAAGATCTCGAGATCTTGGAGACTATGAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013533
GPR162 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 162
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013533.2-2117s1c1
Sequence:CCGGGCCTTCGACAGTTTCTAGAAACTCGAGTTTCTAGAAACTGTCGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013533.2-1923s1c1
Sequence:CCGGCCACGATGAGACCAACATCTTCTCGAGAAGATGTTGGTCTCATCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013533.2-777s1c1
Sequence:CCGGCGCTTGGATCATCCTTAGCATCTCGAGATGCTAAGGATGATCCAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013533.2-1875s1c1
Sequence:CCGGGCTGGAGAGAGTACACTACTTCTCGAGAAGTAGTGTACTCTCTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013533.2-1980s1c1
Sequence:CCGGGTGGTCCTCATCGGATGATATCTCGAGATATCATCCGATGAGGACCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013533
GPR162 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 162
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013533.2-2117s1c1
Sequence:CCGGGCCTTCGACAGTTTCTAGAAACTCGAGTTTCTAGAAACTGTCGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013533.2-1923s1c1
Sequence:CCGGCCACGATGAGACCAACATCTTCTCGAGAAGATGTTGGTCTCATCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013533.2-777s1c1
Sequence:CCGGCGCTTGGATCATCCTTAGCATCTCGAGATGCTAAGGATGATCCAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013533.2-1875s1c1
Sequence:CCGGGCTGGAGAGAGTACACTACTTCTCGAGAAGTAGTGTACTCTCTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013533.2-1980s1c1
Sequence:CCGGGTGGTCCTCATCGGATGATATCTCGAGATATCATCCGATGAGGACCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013533
GPR162 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 162
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013533.2-2117s1c1
Sequence:CCGGGCCTTCGACAGTTTCTAGAAACTCGAGTTTCTAGAAACTGTCGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013533.2-1923s1c1
Sequence:CCGGCCACGATGAGACCAACATCTTCTCGAGAAGATGTTGGTCTCATCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013533.2-777s1c1
Sequence:CCGGCGCTTGGATCATCCTTAGCATCTCGAGATGCTAAGGATGATCCAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013533.2-1875s1c1
Sequence:CCGGGCTGGAGAGAGTACACTACTTCTCGAGAAGTAGTGTACTCTCTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013533.2-1980s1c1
Sequence:CCGGGTGGTCCTCATCGGATGATATCTCGAGATATCATCCGATGAGGACCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks