EMAIL THIS PAGE TO A FRIEND

GPR171

G protein-coupled receptor 171

51 Gene Product Result for
Synonyms: H963
UniProtKB ID: O14626, D3DNJ4, Q8IV06
Gene ID:
Mouse(229323) G protein-coupled receptor 171
Rat(688737) G protein-coupled receptor 171
sheep(101118323) G protein-coupled receptor 171
chicken(425040) G protein-coupled receptor 171
chicken(101669161) G protein-coupled receptor 171
chicken(101749516) G protein-coupled receptor 171
dog(485716) G protein-coupled receptor 171
domestic cat(101093133) G protein-coupled receptor 171
cow(767929) G protein-coupled receptor 171
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173398 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173398 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173398 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013308 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013308 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013308 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013308 Rosetta Predictions human pricing
NM_001109510 Rosetta Predictions rat pricing
NM_173398 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013308 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106656 predicted 549
2 SASI_Hs01_00106657 predicted 654
3 SASI_Hs01_00106659 predicted 674
4 SASI_Hs01_00106660 predicted 600
5 SASI_Hs01_00106661 predicted 613
6 SASI_Hs01_00106662 predicted 516
7 SASI_Hs01_00106663 predicted 762
8 SASI_Hs02_00344585 predicted 592
9 SASI_Hs01_00106664 predicted 993
10 SASI_Hs01_00106665 predicted 564
11 SASI_Hs01_00106658 predicted 778
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109510 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249109 predicted 710
2 SASI_Rn02_00249110 predicted 809
3 SASI_Rn02_00249111 predicted 663
4 SASI_Rn02_00249112 predicted 477
5 SASI_Rn02_00249113 predicted 1194
6 SASI_Rn02_00249114 predicted 1067
7 SASI_Rn02_00249115 predicted 709
8 SASI_Rn02_00249116 predicted 1096
9 SASI_Rn02_00249117 predicted 975
10 SASI_Rn02_00249118 predicted 649
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173398 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345246 predicted 879
2 SASI_Mm02_00345247 predicted 622
3 SASI_Mm02_00345248 predicted 952
4 SASI_Mm02_00345249 predicted 865
5 SASI_Mm02_00345250 predicted 798
6 SASI_Mm02_00345251 predicted 1238
7 SASI_Mm02_00345252 predicted 564
8 SASI_Mm02_00345253 predicted 862
9 SASI_Mm02_00345254 predicted 1327
10 SASI_Mm02_00345255 predicted 557
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173398
GPR171 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 171
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173398.1-549s1c1
Sequence:CCGGCCTCATCTACATCAATATGTACTCGAGTACATATTGATGTAGATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173398.1-1122s1c1
Sequence:CCGGCCTGTACTATCATCTGTCAAACTCGAGTTTGACAGATGATAGTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027524    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173398.1-1386s1c1
Sequence:CCGGCCTTTCTTCAATCCAAGCCAACTCGAGTTGGCTTGGATTGAAGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173398.1-786s1c1
Sequence:CCGGGTTTGGAAGAAACTGGCATTTCTCGAGAAATGCCAGTTTCTTCCAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173398.1-961s1c1
Sequence:CCGGGCTAGTTACATCATATGCTTTCTCGAGAAAGCATATGATGTAACTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446882    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173398.3-1636s21c1
Sequence:CCGGGCCCTTCAGCGATACCTTAAACTCGAGTTTAAGGTATCGCTGAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173398.3-807s21c1
Sequence:CCGGGTAGGTTGCATGGAGTTTAAACTCGAGTTTAAACTCCATGCAACCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173398.3-651s21c1
Sequence:CCGGGATCGCTGTCTTCAGTTAATACTCGAGTATTAACTGAAGACAGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173398
GPR171 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 171
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173398.1-549s1c1
Sequence:CCGGCCTCATCTACATCAATATGTACTCGAGTACATATTGATGTAGATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173398.1-1122s1c1
Sequence:CCGGCCTGTACTATCATCTGTCAAACTCGAGTTTGACAGATGATAGTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027524    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173398.1-1386s1c1
Sequence:CCGGCCTTTCTTCAATCCAAGCCAACTCGAGTTGGCTTGGATTGAAGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173398.1-786s1c1
Sequence:CCGGGTTTGGAAGAAACTGGCATTTCTCGAGAAATGCCAGTTTCTTCCAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173398.1-961s1c1
Sequence:CCGGGCTAGTTACATCATATGCTTTCTCGAGAAAGCATATGATGTAACTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446882    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173398.3-1636s21c1
Sequence:CCGGGCCCTTCAGCGATACCTTAAACTCGAGTTTAAGGTATCGCTGAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173398.3-807s21c1
Sequence:CCGGGTAGGTTGCATGGAGTTTAAACTCGAGTTTAAACTCCATGCAACCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173398.3-651s21c1
Sequence:CCGGGATCGCTGTCTTCAGTTAATACTCGAGTATTAACTGAAGACAGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173398
GPR171 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 171
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173398.1-549s1c1
Sequence:CCGGCCTCATCTACATCAATATGTACTCGAGTACATATTGATGTAGATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173398.1-1122s1c1
Sequence:CCGGCCTGTACTATCATCTGTCAAACTCGAGTTTGACAGATGATAGTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027524    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173398.1-1386s1c1
Sequence:CCGGCCTTTCTTCAATCCAAGCCAACTCGAGTTGGCTTGGATTGAAGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173398.1-786s1c1
Sequence:CCGGGTTTGGAAGAAACTGGCATTTCTCGAGAAATGCCAGTTTCTTCCAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173398.1-961s1c1
Sequence:CCGGGCTAGTTACATCATATGCTTTCTCGAGAAAGCATATGATGTAACTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446882    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173398.3-1636s21c1
Sequence:CCGGGCCCTTCAGCGATACCTTAAACTCGAGTTTAAGGTATCGCTGAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173398.3-807s21c1
Sequence:CCGGGTAGGTTGCATGGAGTTTAAACTCGAGTTTAAACTCCATGCAACCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173398.3-651s21c1
Sequence:CCGGGATCGCTGTCTTCAGTTAATACTCGAGTATTAACTGAAGACAGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013308
GPR171 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 171
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013308.2-1631s1c1
Sequence:CCGGGCAGCTTACATATAACAACTTCTCGAGAAGTTGTTATATGTAAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013308.2-1080s1c1
Sequence:CCGGCCTGTACTATCACCTCTCAAACTCGAGTTTGAGAGGTGATAGTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013308.2-600s1c1
Sequence:CCGGCCGAATACAAGAACCCGGATTCTCGAGAATCCGGGTTCTTGTATTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013308.2-502s1c1
Sequence:CCGGGCCTGCCTCATCTATATCAATCTCGAGATTGATATAGATGAGGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013308.2-831s1c1
Sequence:CCGGCCTTGTAATTCGACAGCTCTACTCGAGTAGAGCTGTCGAATTACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013308.3-279s21c1
Sequence:CCGGTCTGGAGCCATTCACGTATTTCTCGAGAAATACGTGAATGGCTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013308.3-1229s21c1
Sequence:CCGGTGGCCTTACTGGACCATAAAGCTCGAGCTTTATGGTCCAGTAAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013308.3-923s21c1
Sequence:CCGGTGACCACGGGCTACATCATATCTCGAGATATGATGTAGCCCGTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013308
GPR171 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 171
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013308.2-1631s1c1
Sequence:CCGGGCAGCTTACATATAACAACTTCTCGAGAAGTTGTTATATGTAAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013308.2-1080s1c1
Sequence:CCGGCCTGTACTATCACCTCTCAAACTCGAGTTTGAGAGGTGATAGTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013308.2-600s1c1
Sequence:CCGGCCGAATACAAGAACCCGGATTCTCGAGAATCCGGGTTCTTGTATTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013308.2-502s1c1
Sequence:CCGGGCCTGCCTCATCTATATCAATCTCGAGATTGATATAGATGAGGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013308.2-831s1c1
Sequence:CCGGCCTTGTAATTCGACAGCTCTACTCGAGTAGAGCTGTCGAATTACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013308.3-279s21c1
Sequence:CCGGTCTGGAGCCATTCACGTATTTCTCGAGAAATACGTGAATGGCTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013308.3-1229s21c1
Sequence:CCGGTGGCCTTACTGGACCATAAAGCTCGAGCTTTATGGTCCAGTAAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013308.3-923s21c1
Sequence:CCGGTGACCACGGGCTACATCATATCTCGAGATATGATGTAGCCCGTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013308
GPR171 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 171
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013308.2-1631s1c1
Sequence:CCGGGCAGCTTACATATAACAACTTCTCGAGAAGTTGTTATATGTAAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013308.2-1080s1c1
Sequence:CCGGCCTGTACTATCACCTCTCAAACTCGAGTTTGAGAGGTGATAGTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013308.2-600s1c1
Sequence:CCGGCCGAATACAAGAACCCGGATTCTCGAGAATCCGGGTTCTTGTATTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013308.2-502s1c1
Sequence:CCGGGCCTGCCTCATCTATATCAATCTCGAGATTGATATAGATGAGGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013308.2-831s1c1
Sequence:CCGGCCTTGTAATTCGACAGCTCTACTCGAGTAGAGCTGTCGAATTACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013308.3-279s21c1
Sequence:CCGGTCTGGAGCCATTCACGTATTTCTCGAGAAATACGTGAATGGCTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013308.3-1229s21c1
Sequence:CCGGTGGCCTTACTGGACCATAAAGCTCGAGCTTTATGGTCCAGTAAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013308.3-923s21c1
Sequence:CCGGTGACCACGGGCTACATCATATCTCGAGATATGATGTAGCCCGTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks