EMAIL THIS PAGE TO A FRIEND

GPR173

G protein-coupled receptor 173

Synonyms: SREB3
UniProtKB ID: Q9NS66, B1B0A5
Gene ID:
Human(54328) Summary: This gene encodes a member of the G-protein coupled receptor 1 family. This protein contains 7 transmembrane domains and conserved cysteine residues. [provided by RefSeq, Nov 2009]
Mouse(70771) G-protein coupled receptor 173
Rat(64021) G-protein coupled receptor 173
Zebrafish(57926) G-protein coupled receptor 173
cow(515148) G protein-coupled receptor 173
domestic cat(101089675) G protein-coupled receptor 173
dog(491892) G protein-coupled receptor 173
domestic guinea pig(100719280) G protein-coupled receptor 173
naked mole-rat(101707380) G protein-coupled receptor 173
sheep(101122079) G protein-coupled receptor 173
Domestic Rabbit(100341211) G protein-coupled receptor 173
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018969 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018969 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018969 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027543 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027543 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027543 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018969 Rosetta Predictions human pricing
NM_022255 Rosetta Predictions rat pricing
NM_027543 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018969 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019962 predicted 1295
2 SASI_Hs01_00019964 predicted 864
3 SASI_Hs01_00019965 predicted 536
4 SASI_Hs01_00019966 predicted 599
5 SASI_Hs01_00019967 predicted 640
6 SASI_Hs01_00019968 predicted 1165
7 SASI_Hs01_00019969 predicted 407
8 SASI_Hs01_00019970 predicted 785
9 SASI_Hs01_00019971 predicted 535
10 SASI_Hs02_00352450 predicted 747
11 SASI_Hs01_00019963 predicted 538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022255 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032995 predicted 377
2 SASI_Rn02_00263045 predicted 278
3 SASI_Rn01_00032996 predicted 524
4 SASI_Rn01_00032997 predicted 517
5 SASI_Rn01_00032998 predicted 845
6 SASI_Rn01_00033000 predicted 481
7 SASI_Rn01_00033001 predicted 396
8 SASI_Rn01_00033002 predicted 762
9 SASI_Rn01_00033003 predicted 603
10 SASI_Rn01_00033004 predicted 483
11 SASI_Rn01_00032999 predicted 349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027543 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059210 predicted 766
2 SASI_Mm01_00059211 predicted 662
3 SASI_Mm01_00059212 predicted 1282
4 SASI_Mm01_00059213 predicted 899
5 SASI_Mm01_00059214 predicted 1339
6 SASI_Mm01_00059215 predicted 1231
7 SASI_Mm01_00059216 predicted 986
8 SASI_Mm01_00059217 predicted 866
9 SASI_Mm01_00059218 predicted 1243
10 SASI_Mm01_00059219 predicted 1503
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018969
GPR173 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 173
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018969.4-740s21c1
Sequence:CCGGACGTGGGCACCTACAAGTTTACTCGAGTAAACTTGTAGGTGCCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018969.4-875s21c1
Sequence:CCGGAGCTGCTCCTCTTCGAGTATCCTCGAGGATACTCGAAGAGGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018969.4-337s21c1
Sequence:CCGGGTACTGCTGGGACTGATTATGCTCGAGCATAATCAGTCCCAGCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018969.3-1507s1c1
Sequence:CCGGACCTGTAATCTAGGCACCTTTCTCGAGAAAGGTGCCTAGATTACAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018969.3-542s1c1
Sequence:CCGGGCTGCAAGATTGTGGCCTTTACTCGAGTAAAGGCCACAATCTTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018969.3-1227s1c1
Sequence:CCGGCACTGCTGTTTGGATGAGCTTCTCGAGAAGCTCATCCAAACAGCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018969.3-335s1c1
Sequence:CCGGTGGTACTGCTAGGACTGATTACTCGAGTAATCAGTCCTAGCAGTACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018969.3-790s1c1
Sequence:CCGGCATCGCTACTTCAAGGCCAATCTCGAGATTGGCCTTGAAGTAGCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018969
GPR173 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 173
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018969.4-740s21c1
Sequence:CCGGACGTGGGCACCTACAAGTTTACTCGAGTAAACTTGTAGGTGCCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018969.4-875s21c1
Sequence:CCGGAGCTGCTCCTCTTCGAGTATCCTCGAGGATACTCGAAGAGGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018969.4-337s21c1
Sequence:CCGGGTACTGCTGGGACTGATTATGCTCGAGCATAATCAGTCCCAGCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018969.3-1507s1c1
Sequence:CCGGACCTGTAATCTAGGCACCTTTCTCGAGAAAGGTGCCTAGATTACAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018969.3-542s1c1
Sequence:CCGGGCTGCAAGATTGTGGCCTTTACTCGAGTAAAGGCCACAATCTTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018969.3-1227s1c1
Sequence:CCGGCACTGCTGTTTGGATGAGCTTCTCGAGAAGCTCATCCAAACAGCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018969.3-335s1c1
Sequence:CCGGTGGTACTGCTAGGACTGATTACTCGAGTAATCAGTCCTAGCAGTACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018969.3-790s1c1
Sequence:CCGGCATCGCTACTTCAAGGCCAATCTCGAGATTGGCCTTGAAGTAGCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018969
GPR173 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 173
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018969.4-740s21c1
Sequence:CCGGACGTGGGCACCTACAAGTTTACTCGAGTAAACTTGTAGGTGCCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018969.4-875s21c1
Sequence:CCGGAGCTGCTCCTCTTCGAGTATCCTCGAGGATACTCGAAGAGGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018969.4-337s21c1
Sequence:CCGGGTACTGCTGGGACTGATTATGCTCGAGCATAATCAGTCCCAGCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018969.3-1507s1c1
Sequence:CCGGACCTGTAATCTAGGCACCTTTCTCGAGAAAGGTGCCTAGATTACAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018969.3-542s1c1
Sequence:CCGGGCTGCAAGATTGTGGCCTTTACTCGAGTAAAGGCCACAATCTTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018969.3-1227s1c1
Sequence:CCGGCACTGCTGTTTGGATGAGCTTCTCGAGAAGCTCATCCAAACAGCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018969.3-335s1c1
Sequence:CCGGTGGTACTGCTAGGACTGATTACTCGAGTAATCAGTCCTAGCAGTACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018969.3-790s1c1
Sequence:CCGGCATCGCTACTTCAAGGCCAATCTCGAGATTGGCCTTGAAGTAGCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027543
GPR173 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 173
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027543.3-1238s1c1
Sequence:CCGGGCCGAATGTTCTACGCGATTACTCGAGTAATCGCGTAGAACATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027543.3-1407s1c1
Sequence:CCGGCCTGCTTAACAAGGACCTCAACTCGAGTTGAGGTCCTTGTTAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027543.3-915s1c1
Sequence:CCGGGCATCGCTACTTCAAAGCAAACTCGAGTTTGCTTTGAAGTAGCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125039    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027543.3-2493s1c1
Sequence:CCGGCCCACAATTATCCCTTGGGTTCTCGAGAACCCAAGGGATAATTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027543.3-668s1c1
Sequence:CCGGGCTGTAAGATTGTGGCCTTTACTCGAGTAAAGGCCACAATCTTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027543
GPR173 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 173
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027543.3-1238s1c1
Sequence:CCGGGCCGAATGTTCTACGCGATTACTCGAGTAATCGCGTAGAACATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027543.3-1407s1c1
Sequence:CCGGCCTGCTTAACAAGGACCTCAACTCGAGTTGAGGTCCTTGTTAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027543.3-915s1c1
Sequence:CCGGGCATCGCTACTTCAAAGCAAACTCGAGTTTGCTTTGAAGTAGCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125039    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027543.3-2493s1c1
Sequence:CCGGCCCACAATTATCCCTTGGGTTCTCGAGAACCCAAGGGATAATTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027543.3-668s1c1
Sequence:CCGGGCTGTAAGATTGTGGCCTTTACTCGAGTAAAGGCCACAATCTTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027543
GPR173 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 173
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027543.3-1238s1c1
Sequence:CCGGGCCGAATGTTCTACGCGATTACTCGAGTAATCGCGTAGAACATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027543.3-1407s1c1
Sequence:CCGGCCTGCTTAACAAGGACCTCAACTCGAGTTGAGGTCCTTGTTAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027543.3-915s1c1
Sequence:CCGGGCATCGCTACTTCAAAGCAAACTCGAGTTTGCTTTGAAGTAGCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125039    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027543.3-2493s1c1
Sequence:CCGGCCCACAATTATCCCTTGGGTTCTCGAGAACCCAAGGGATAATTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027543.3-668s1c1
Sequence:CCGGGCTGTAAGATTGTGGCCTTTACTCGAGTAAAGGCCACAATCTTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks