EMAIL THIS PAGE TO A FRIEND

GPR174

G protein-coupled receptor 174

51 Gene Product Result for
Synonyms: GPCR17
UniProtKB ID: Q9BXC1, Q2M3F7
Gene ID:
Human(84636) Summary: This gene encodes a protein belonging to the G protein-coupled receptor superfamily. These proteins are characterized by the presence of seven alpha-helical transmembrane domains, and they activate or interact with various endogenous or exogenous ligands, including neurotransmitters, hormones, and odorant and taste substances. This family member is classified as an orphan receptor because the cognate ligand has not been identified. [provided by RefSeq, Sep 2011]
Mouse(213439) G protein-coupled receptor 174
Rat(302373) G protein-coupled receptor 174
sheep(101119371) G protein-coupled receptor 174
Domestic Rabbit(100344765) G protein-coupled receptor 174
domestic guinea pig(100722265) G protein-coupled receptor 174
naked mole-rat(101702522) G protein-coupled receptor 174
chicken(422146) G protein-coupled receptor 174
domestic cat(101090420) G protein-coupled receptor 174
cow(781056) G protein-coupled receptor 174
Horse(100071745) G protein-coupled receptor 174
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032553 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032553 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032553 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033251 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033251 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033251 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU027671 MISSION® esiRNA esiRNA human GPR174 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032553 Rosetta Predictions human pricing
NM_001106938 Rosetta Predictions rat pricing
NM_001033251 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032553 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097718 predicted 994
2 SASI_Hs01_00097719 predicted 626
3 SASI_Hs01_00097720 predicted 862
4 SASI_Hs01_00097721 predicted 516
5 SASI_Hs01_00097722 predicted 456
6 SASI_Hs01_00097723 predicted 526
7 SASI_Hs01_00097724 predicted 525
8 SASI_Hs01_00097725 predicted 313
9 SASI_Hs01_00097726 predicted 506
10 SASI_Hs01_00097727 predicted 502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106938 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223886 predicted 973
2 SASI_Rn02_00223887 predicted 1389
3 SASI_Rn02_00223888 predicted 1035
4 SASI_Rn02_00223889 predicted 711
5 SASI_Rn02_00223890 predicted 921
6 SASI_Rn02_00223891 predicted 1442
7 SASI_Rn02_00223892 predicted 1720
8 SASI_Rn02_00223893 predicted 1533
9 SASI_Rn02_00223894 predicted 1696
10 SASI_Rn02_00223895 predicted 837
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033251 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109257 predicted 1362
2 SASI_Mm01_00109258 predicted 1262
3 SASI_Mm01_00109259 predicted 1379
4 SASI_Mm02_00288417 predicted 1614
5 SASI_Mm01_00109260 predicted 1251
6 SASI_Mm01_00109261 predicted 1927
7 SASI_Mm02_00288418 predicted 1897
8 SASI_Mm01_00109262 predicted 1753
9 SASI_Mm01_00109263 predicted 1271
10 SASI_Mm01_00109264 predicted 1352
11 SASI_Mm01_00109256 predicted 1148
12 SASI_Mm01_00109265 predicted 938
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032553
GPR174 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 174
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008261    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032553.1-1078s1c1
Sequence:CCGGCATCAGAACATATCTGCAATACTCGAGTATTGCAGATATGTTCTGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032553.1-626s1c1
Sequence:CCGGCGCTTCTGATTGTCCTATATTCTCGAGAATATAGGACAATCAGAAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032553.1-226s1c1
Sequence:CCGGGCTGACTTACTACAAGTTCTTCTCGAGAAGAACTTGTAGTAAGTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032553.1-518s1c1
Sequence:CCGGCCTCTGGCAATAGGACCAAATCTCGAGATTTGGTCCTATTGCCAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032553.1-1013s1c1
Sequence:CCGGCCACCATGACACCTGAATTATCTCGAGATAATTCAGGTGTCATGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032553.1-367s21c1
Sequence:CCGGTGCATCAGTGTGCGACGATTTCTCGAGAAATCGTCGCACACTGATGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032553.1-627s21c1
Sequence:CCGGGCTTCTGATTGTCCTATATTGCTCGAGCAATATAGGACAATCAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032553.1-159s21c1
Sequence:CCGGGTGGGTATTCTATGGTTATATCTCGAGATATAACCATAGAATACCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032553
GPR174 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 174
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008261    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032553.1-1078s1c1
Sequence:CCGGCATCAGAACATATCTGCAATACTCGAGTATTGCAGATATGTTCTGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032553.1-626s1c1
Sequence:CCGGCGCTTCTGATTGTCCTATATTCTCGAGAATATAGGACAATCAGAAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032553.1-226s1c1
Sequence:CCGGGCTGACTTACTACAAGTTCTTCTCGAGAAGAACTTGTAGTAAGTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032553.1-518s1c1
Sequence:CCGGCCTCTGGCAATAGGACCAAATCTCGAGATTTGGTCCTATTGCCAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032553.1-1013s1c1
Sequence:CCGGCCACCATGACACCTGAATTATCTCGAGATAATTCAGGTGTCATGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032553.1-367s21c1
Sequence:CCGGTGCATCAGTGTGCGACGATTTCTCGAGAAATCGTCGCACACTGATGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032553.1-627s21c1
Sequence:CCGGGCTTCTGATTGTCCTATATTGCTCGAGCAATATAGGACAATCAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032553.1-159s21c1
Sequence:CCGGGTGGGTATTCTATGGTTATATCTCGAGATATAACCATAGAATACCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032553
GPR174 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 174
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008261    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032553.1-1078s1c1
Sequence:CCGGCATCAGAACATATCTGCAATACTCGAGTATTGCAGATATGTTCTGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032553.1-626s1c1
Sequence:CCGGCGCTTCTGATTGTCCTATATTCTCGAGAATATAGGACAATCAGAAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032553.1-226s1c1
Sequence:CCGGGCTGACTTACTACAAGTTCTTCTCGAGAAGAACTTGTAGTAAGTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032553.1-518s1c1
Sequence:CCGGCCTCTGGCAATAGGACCAAATCTCGAGATTTGGTCCTATTGCCAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032553.1-1013s1c1
Sequence:CCGGCCACCATGACACCTGAATTATCTCGAGATAATTCAGGTGTCATGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032553.1-367s21c1
Sequence:CCGGTGCATCAGTGTGCGACGATTTCTCGAGAAATCGTCGCACACTGATGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032553.1-627s21c1
Sequence:CCGGGCTTCTGATTGTCCTATATTGCTCGAGCAATATAGGACAATCAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032553.1-159s21c1
Sequence:CCGGGTGGGTATTCTATGGTTATATCTCGAGATATAACCATAGAATACCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033251
GPR174 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 174
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033251.2-2116s21c1
Sequence:CCGGTGATAATACTGCGCACATATTCTCGAGAATATGTGCGCAGTATTATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033251.2-1047s21c1
Sequence:CCGGCTAGCCATTGCTGACTTATTACTCGAGTAATAAGTCAGCAATGGCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033251.2-1197s21c1
Sequence:CCGGTGCATCAGTGTGCGAAGATTTCTCGAGAAATCTTCGCACACTGATGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033251.2-1721s21c1
Sequence:CCGGCTGTCTTGACCCAGTTATATACTCGAGTATATAACTGGGTCAAGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033251.2-978s21c1
Sequence:CCGGATATTAGCCTTATGGGTATTTCTCGAGAAATACCCATAAGGCTAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033251
GPR174 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 174
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033251.2-2116s21c1
Sequence:CCGGTGATAATACTGCGCACATATTCTCGAGAATATGTGCGCAGTATTATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033251.2-1047s21c1
Sequence:CCGGCTAGCCATTGCTGACTTATTACTCGAGTAATAAGTCAGCAATGGCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033251.2-1197s21c1
Sequence:CCGGTGCATCAGTGTGCGAAGATTTCTCGAGAAATCTTCGCACACTGATGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033251.2-1721s21c1
Sequence:CCGGCTGTCTTGACCCAGTTATATACTCGAGTATATAACTGGGTCAAGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033251.2-978s21c1
Sequence:CCGGATATTAGCCTTATGGGTATTTCTCGAGAAATACCCATAAGGCTAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033251
GPR174 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 174
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033251.2-2116s21c1
Sequence:CCGGTGATAATACTGCGCACATATTCTCGAGAATATGTGCGCAGTATTATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033251.2-1047s21c1
Sequence:CCGGCTAGCCATTGCTGACTTATTACTCGAGTAATAAGTCAGCAATGGCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033251.2-1197s21c1
Sequence:CCGGTGCATCAGTGTGCGAAGATTTCTCGAGAAATCTTCGCACACTGATGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033251.2-1721s21c1
Sequence:CCGGCTGTCTTGACCCAGTTATATACTCGAGTATATAACTGGGTCAAGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033251.2-978s21c1
Sequence:CCGGATATTAGCCTTATGGGTATTTCTCGAGAAATACCCATAAGGCTAATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)