EMAIL THIS PAGE TO A FRIEND

GPR176

G protein-coupled receptor 176

71 Gene Product Result for
Synonyms: HB-954
UniProtKB ID: Q14439, Q6NXF6
Gene ID:
Human(11245) Summary: Members of the G protein-coupled receptor family, such as GPR176, are cell surface receptors involved in responses to hormones, growth factors, and neurotransmitters (Hata et al., 1995 [PubMed 7893747]
Mouse(381413) G protein-coupled receptor 176
Rat(117257) G protein-coupled receptor 176
Zebrafish(561969) G protein-coupled receptor 176
cow(525734) G protein-coupled receptor 176
Horse(100057438) G protein-coupled receptor 176
domestic cat(101092188) G protein-coupled receptor 176
dog(487488) G protein-coupled receptor 176
chicken(428879) G protein-coupled receptor 176
domestic guinea pig(100735959) G protein-coupled receptor 176
sheep(101107100) G protein-coupled receptor 176
Domestic Rabbit(100358547) G protein-coupled receptor 176
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007223 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007223 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007223 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_355375 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_355375 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_355375 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007223 Rosetta Predictions human pricing
XM_001080723 Rosetta Predictions rat pricing
XM_342493 Rosetta Predictions rat pricing
NM_201367 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007223 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100902 predicted 866
2 SASI_Hs01_00100903 predicted 1344
3 SASI_Hs01_00100904 predicted 2442
4 SASI_Hs01_00100905 predicted 1298
5 SASI_Hs01_00100906 predicted 1067
6 SASI_Hs01_00100907 predicted 1384
7 SASI_Hs01_00100908 predicted 1814
8 SASI_Hs01_00100910 predicted 2199
9 SASI_Hs01_00100911 predicted 1976
10 SASI_Hs02_00343225 predicted 1194
11 SASI_Hs01_00100909 predicted 1410
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080723 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00369068 predicted 1783
2 SASI_Rn02_00369069 predicted 2107
3 SASI_Rn02_00369070 predicted 1009
4 SASI_Rn02_00369071 predicted 1635
5 SASI_Rn02_00369072 predicted 1167
6 SASI_Rn02_00369073 predicted 789
7 SASI_Rn02_00369074 predicted 1790
8 SASI_Rn02_00369075 predicted 1816
9 SASI_Rn02_00369076 predicted 1341
10 SASI_Rn02_00369077 predicted 719
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342493 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394359 predicted 1787
2 SASI_Rn02_00394360 predicted 2100
3 SASI_Rn02_00394361 predicted 1005
4 SASI_Rn02_00394362 predicted 1643
5 SASI_Rn02_00394363 predicted 1169
6 SASI_Rn02_00394364 predicted 790
7 SASI_Rn02_00394365 predicted 1792
8 SASI_Rn02_00394366 predicted 1813
9 SASI_Rn02_00394367 predicted 1340
10 SASI_Rn02_00394368 predicted 727
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201367 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109700 predicted 1442
2 SASI_Mm02_00351524 predicted 1075
3 SASI_Mm01_00109701 predicted 443
4 SASI_Mm01_00109702 predicted 1446
5 SASI_Mm01_00109703 predicted 540
6 SASI_Mm01_00109704 predicted 371
7 SASI_Mm01_00109705 predicted 1239
8 SASI_Mm01_00109706 predicted 657
9 SASI_Mm01_00109707 predicted 311
10 SASI_Mm01_00109708 predicted 723
11 SASI_Mm01_00109709 predicted 992
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007223
GPR176 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 176
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007223.1-1990s21c1
Sequence:CCGGTTGGGCAGCAGCAGATCTTTACTCGAGTAAAGATCTGCTGCTGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007223.1-1492s21c1
Sequence:CCGGATAACATCACCACGGTCATTGCTCGAGCAATGACCGTGGTGATGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007223.1-1036s21c1
Sequence:CCGGTCGGAAACTTCATGGTGTTATCTCGAGATAACACCATGAAGTTTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007223.1-2586s1c1
Sequence:CCGGCCTCTTTATTGAGGGAGTATACTCGAGTATACTCCCTCAATAAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007223.1-1608s1c1
Sequence:CCGGCCACAGAACACCATCTCTATTCTCGAGAATAGAGATGGTGTTCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007223.1-1076s1c1
Sequence:CCGGCGTGTTCAAATCTGTCACCAACTCGAGTTGGTGACAGATTTGAACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007223.1-2360s1c1
Sequence:CCGGGCGGAAGATGAGCAGAAACAACTCGAGTTGTTTCTGCTCATCTTCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007223.1-1034s1c1
Sequence:CCGGGCTCGGAAACTTCATGGTGTTCTCGAGAACACCATGAAGTTTCCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007223
GPR176 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 176
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007223.1-1990s21c1
Sequence:CCGGTTGGGCAGCAGCAGATCTTTACTCGAGTAAAGATCTGCTGCTGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007223.1-1492s21c1
Sequence:CCGGATAACATCACCACGGTCATTGCTCGAGCAATGACCGTGGTGATGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007223.1-1036s21c1
Sequence:CCGGTCGGAAACTTCATGGTGTTATCTCGAGATAACACCATGAAGTTTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007223.1-2586s1c1
Sequence:CCGGCCTCTTTATTGAGGGAGTATACTCGAGTATACTCCCTCAATAAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007223.1-1608s1c1
Sequence:CCGGCCACAGAACACCATCTCTATTCTCGAGAATAGAGATGGTGTTCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007223.1-1076s1c1
Sequence:CCGGCGTGTTCAAATCTGTCACCAACTCGAGTTGGTGACAGATTTGAACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007223.1-2360s1c1
Sequence:CCGGGCGGAAGATGAGCAGAAACAACTCGAGTTGTTTCTGCTCATCTTCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007223.1-1034s1c1
Sequence:CCGGGCTCGGAAACTTCATGGTGTTCTCGAGAACACCATGAAGTTTCCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007223
GPR176 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 176
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007223.1-1990s21c1
Sequence:CCGGTTGGGCAGCAGCAGATCTTTACTCGAGTAAAGATCTGCTGCTGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007223.1-1492s21c1
Sequence:CCGGATAACATCACCACGGTCATTGCTCGAGCAATGACCGTGGTGATGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007223.1-1036s21c1
Sequence:CCGGTCGGAAACTTCATGGTGTTATCTCGAGATAACACCATGAAGTTTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007223.1-2586s1c1
Sequence:CCGGCCTCTTTATTGAGGGAGTATACTCGAGTATACTCCCTCAATAAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007223.1-1608s1c1
Sequence:CCGGCCACAGAACACCATCTCTATTCTCGAGAATAGAGATGGTGTTCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007223.1-1076s1c1
Sequence:CCGGCGTGTTCAAATCTGTCACCAACTCGAGTTGGTGACAGATTTGAACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007223.1-2360s1c1
Sequence:CCGGGCGGAAGATGAGCAGAAACAACTCGAGTTGTTTCTGCTCATCTTCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007223.1-1034s1c1
Sequence:CCGGGCTCGGAAACTTCATGGTGTTCTCGAGAACACCATGAAGTTTCCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_355375
GPR176 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 176
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355375.1-429s1c1
Sequence:CCGGGCCGCACAACAGTGTTCAAATCTCGAGATTTGAACACTGTTGTGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355375.1-1183s1c1
Sequence:CCGGGCTCTTCTTAACTGTGAACAACTCGAGTTGTTCACAGTTAAGAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355375.1-556s1c1
Sequence:CCGGGTGGATCTATACGATGCTCTTCTCGAGAAGAGCATCGTATAGATCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355375.1-839s1c1
Sequence:CCGGGTGTATGTTCTGATCTACAATCTCGAGATTGTAGATCAGAACATACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355375.1-1738s1c1
Sequence:CCGGCAGAAACAATAAAGTGAGCATCTCGAGATGCTCACTTTATTGTTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_355375
GPR176 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 176
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355375.1-429s1c1
Sequence:CCGGGCCGCACAACAGTGTTCAAATCTCGAGATTTGAACACTGTTGTGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355375.1-1183s1c1
Sequence:CCGGGCTCTTCTTAACTGTGAACAACTCGAGTTGTTCACAGTTAAGAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355375.1-556s1c1
Sequence:CCGGGTGGATCTATACGATGCTCTTCTCGAGAAGAGCATCGTATAGATCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355375.1-839s1c1
Sequence:CCGGGTGTATGTTCTGATCTACAATCTCGAGATTGTAGATCAGAACATACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355375.1-1738s1c1
Sequence:CCGGCAGAAACAATAAAGTGAGCATCTCGAGATGCTCACTTTATTGTTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_355375
GPR176 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 176
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355375.1-429s1c1
Sequence:CCGGGCCGCACAACAGTGTTCAAATCTCGAGATTTGAACACTGTTGTGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355375.1-1183s1c1
Sequence:CCGGGCTCTTCTTAACTGTGAACAACTCGAGTTGTTCACAGTTAAGAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355375.1-556s1c1
Sequence:CCGGGTGGATCTATACGATGCTCTTCTCGAGAAGAGCATCGTATAGATCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355375.1-839s1c1
Sequence:CCGGGTGTATGTTCTGATCTACAATCTCGAGATTGTAGATCAGAACATACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355375.1-1738s1c1
Sequence:CCGGCAGAAACAATAAAGTGAGCATCTCGAGATGCTCACTTTATTGTTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks