EMAIL THIS PAGE TO A FRIEND

GPR179

G protein-coupled receptor 179

70 Gene Product Result for
Synonyms: CSNB1E GPR158L GPR158L1
UniProtKB ID: Q6PRD1
Gene ID:
Human(440435) Summary: This gene encodes a member of the glutamate receptor subfamily of G protein-coupled receptors. The encoded protein has an EGF-like calcium binding domain and a seven transmembrane domain in the N-terminal region of the protein. Mutations in this gene are associated with congenital stationary night blindness type 1E. [provided by RefSeq, Apr 2012]
Mouse(217143) G protein-coupled receptor 179
Rat(287657) G protein-coupled receptor 179
sheep(101123135) G protein-coupled receptor 179
Domestic Rabbit(100351284) G protein-coupled receptor 179
domestic guinea pig(100724362) G protein-coupled receptor 179
naked mole-rat(101705230) G protein-coupled receptor 179
dog(491040) G protein-coupled receptor 179
domestic cat(101098590) G protein-coupled receptor 179
Horse(100069089) G protein-coupled receptor 179
cow(787335) G protein-coupled receptor 179
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004334 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004334 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004334 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081220 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081220 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081220 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004334 Rosetta Predictions human pricing
XM_001081370 Rosetta Predictions rat pricing
XM_220919 Rosetta Predictions rat pricing
NM_001081220 Rosetta Predictions mouse pricing
XM_484070 Rosetta Predictions mouse pricing
XM_903022 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004334 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087619 predicted 5611
2 SASI_Hs01_00087620 predicted 6902
3 SASI_Hs01_00087621 predicted 6932
4 SASI_Hs01_00087622 predicted 7031
5 SASI_Hs01_00087623 predicted 601
6 SASI_Hs01_00087624 predicted 3429
7 SASI_Hs02_00304557 predicted 5879
8 SASI_Hs01_00087625 predicted 4680
9 SASI_Hs01_00087626 predicted 228
10 SASI_Hs01_00087627 predicted 2397
11 SASI_Hs01_00087628 predicted 4210
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081370 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00371603 predicted 6500
2 SASI_Rn02_00371604 predicted 4740
3 SASI_Rn02_00371605 predicted 310
4 SASI_Rn02_00371606 predicted 3491
5 SASI_Rn02_00371607 predicted 3824
6 SASI_Rn02_00371608 predicted 1300
7 SASI_Rn02_00371609 predicted 3579
8 SASI_Rn02_00371610 predicted 4444
9 SASI_Rn02_00371611 predicted 831
10 SASI_Rn02_00371612 predicted 1715
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220919 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379659 predicted 6496
2 SASI_Rn02_00379660 predicted 4737
3 SASI_Rn02_00379661 predicted 310
4 SASI_Rn02_00379662 predicted 3492
5 SASI_Rn02_00379663 predicted 3817
6 SASI_Rn02_00379664 predicted 1299
7 SASI_Rn02_00379665 predicted 3584
8 SASI_Rn02_00379666 predicted 4447
9 SASI_Rn02_00379667 predicted 828
10 SASI_Rn02_00379668 predicted 1716
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081220 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296361 predicted 3806
2 SASI_Mm02_00296362 predicted 5393
3 SASI_Mm02_00296363 predicted 4846
4 SASI_Mm02_00296364 predicted 6102
5 SASI_Mm02_00296365 predicted 2910
6 SASI_Mm02_00296366 predicted 6443
7 SASI_Mm02_00296367 predicted 6644
8 SASI_Mm02_00296368 predicted 370
9 SASI_Mm02_00296369 predicted 6568
10 SASI_Mm02_00296370 predicted 2641
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_484070 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00214783 predicted 273
2 SASI_Mm01_00214784 predicted 6102
3 SASI_Mm01_00214785 predicted 6244
4 SASI_Mm01_00214786 predicted 6454
5 SASI_Mm01_00214787 predicted 6643
6 SASI_Mm01_00214788 predicted 369
7 SASI_Mm01_00214789 predicted 6574
8 SASI_Mm01_00214790 predicted 6202
9 SASI_Mm01_00214791 predicted 668
10 SASI_Mm01_00214792 predicted 730
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903022 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00208915 predicted 275
2 SASI_Mm01_00208916 predicted 279
3 SASI_Mm01_00208917 predicted 237
4 SASI_Mm01_00208918 predicted 285
5 SASI_Mm01_00208919 predicted 234
6 SASI_Mm01_00208920 predicted 278
7 SASI_Mm01_00208921 predicted 273
8 SASI_Mm01_00208922 predicted 270
9 SASI_Mm01_00208923 predicted 245
10 SASI_Mm01_00208924 predicted 240
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004334
GPR179 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 179
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004334.1-7265s1c1
Sequence:CCGGCCAAAGACAAACTGCATGAAACTCGAGTTTCATGCAGTTTGTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004334.1-6922s1c1
Sequence:CCGGGCCAGTACTTTCACTCTAGAACTCGAGTTCTAGAGTGAAAGTACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004334.1-4039s1c1
Sequence:CCGGCCTGGCAGAATCAGAGACAAACTCGAGTTTGTCTCTGATTCTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004334.1-5188s1c1
Sequence:CCGGGCCATTAGGAAATCTCCAAATCTCGAGATTTGGAGATTTCCTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004334.1-202s1c1
Sequence:CCGGGCTTATCTCTACTCTGGAGATCTCGAGATCTCCAGAGTAGAGATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004334
GPR179 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 179
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004334.1-7265s1c1
Sequence:CCGGCCAAAGACAAACTGCATGAAACTCGAGTTTCATGCAGTTTGTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004334.1-6922s1c1
Sequence:CCGGGCCAGTACTTTCACTCTAGAACTCGAGTTCTAGAGTGAAAGTACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004334.1-4039s1c1
Sequence:CCGGCCTGGCAGAATCAGAGACAAACTCGAGTTTGTCTCTGATTCTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004334.1-5188s1c1
Sequence:CCGGGCCATTAGGAAATCTCCAAATCTCGAGATTTGGAGATTTCCTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004334.1-202s1c1
Sequence:CCGGGCTTATCTCTACTCTGGAGATCTCGAGATCTCCAGAGTAGAGATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004334
GPR179 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 179
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004334.1-7265s1c1
Sequence:CCGGCCAAAGACAAACTGCATGAAACTCGAGTTTCATGCAGTTTGTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004334.1-6922s1c1
Sequence:CCGGGCCAGTACTTTCACTCTAGAACTCGAGTTCTAGAGTGAAAGTACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004334.1-4039s1c1
Sequence:CCGGCCTGGCAGAATCAGAGACAAACTCGAGTTTGTCTCTGATTCTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004334.1-5188s1c1
Sequence:CCGGGCCATTAGGAAATCTCCAAATCTCGAGATTTGGAGATTTCCTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004334.1-202s1c1
Sequence:CCGGGCTTATCTCTACTCTGGAGATCTCGAGATCTCCAGAGTAGAGATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081220
GPR179 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 179
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081220.1-3359s21c1
Sequence:CCGGGGTCTAGGAGCACCTACAAAGCTCGAGCTTTGTAGGTGCTCCTAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081220.1-5778s21c1
Sequence:CCGGCTCGGAACTTCAGCCTATAAGCTCGAGCTTATAGGCTGAAGTTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081220.1-9104s21c1
Sequence:CCGGTCTGCGGCTGTGGTTACTTAACTCGAGTTAAGTAACCACAGCCGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081220.1-4329s21c1
Sequence:CCGGTCCGTGGGAAAGTACTGATTTCTCGAGAAATCAGTACTTTCCCACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081220.1-1429s21c1
Sequence:CCGGGTCGTCTATGGGACCATTATCCTCGAGGATAATGGTCCCATAGACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081220
GPR179 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 179
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081220.1-3359s21c1
Sequence:CCGGGGTCTAGGAGCACCTACAAAGCTCGAGCTTTGTAGGTGCTCCTAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081220.1-5778s21c1
Sequence:CCGGCTCGGAACTTCAGCCTATAAGCTCGAGCTTATAGGCTGAAGTTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081220.1-9104s21c1
Sequence:CCGGTCTGCGGCTGTGGTTACTTAACTCGAGTTAAGTAACCACAGCCGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081220.1-4329s21c1
Sequence:CCGGTCCGTGGGAAAGTACTGATTTCTCGAGAAATCAGTACTTTCCCACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081220.1-1429s21c1
Sequence:CCGGGTCGTCTATGGGACCATTATCCTCGAGGATAATGGTCCCATAGACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081220
GPR179 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 179
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081220.1-3359s21c1
Sequence:CCGGGGTCTAGGAGCACCTACAAAGCTCGAGCTTTGTAGGTGCTCCTAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081220.1-5778s21c1
Sequence:CCGGCTCGGAACTTCAGCCTATAAGCTCGAGCTTATAGGCTGAAGTTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081220.1-9104s21c1
Sequence:CCGGTCTGCGGCTGTGGTTACTTAACTCGAGTTAAGTAACCACAGCCGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081220.1-4329s21c1
Sequence:CCGGTCCGTGGGAAAGTACTGATTTCTCGAGAAATCAGTACTTTCCCACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081220.1-1429s21c1
Sequence:CCGGGTCGTCTATGGGACCATTATCCTCGAGGATAATGGTCCCATAGACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks