EMAIL THIS PAGE TO A FRIEND

GPR17

G protein-coupled receptor 17

52 Gene Product Result for
UniProtKB ID: Q13304, A8K9L0, B2R9X0, Q8N5S7, Q9UDZ6, Q9UE21
Gene ID:
Mouse(574402) G protein-coupled receptor 17
Rat(767613) G protein-coupled receptor 17
chicken(769024) G protein-coupled receptor 17
cow(782442) G protein-coupled receptor 17
domestic cat(101093452) G protein-coupled receptor 17
dog(100688664) G protein-coupled receptor 17
domestic guinea pig(100719279) G protein-coupled receptor 17
naked mole-rat(101699497) G protein-coupled receptor 17
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005291 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005291 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005291 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001025381 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001025381 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001025381 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU159091 MISSION® esiRNA esiRNA human GPR17 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005291 Rosetta Predictions human pricing
NM_001071777 Rosetta Predictions rat pricing
NM_001025381 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005291 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181822 predicted 1079
2 SASI_Hs01_00181823 predicted 1264
3 SASI_Hs01_00181824 predicted 1137
4 SASI_Hs01_00181825 predicted 759
5 SASI_Hs01_00181826 predicted 970
6 SASI_Hs01_00181828 predicted 1278
7 SASI_Hs01_00181829 predicted 1204
8 SASI_Hs01_00181830 predicted 1299
9 SASI_Hs01_00181831 predicted 1076
10 SASI_Hs02_00339339 predicted 1315
11 SASI_Hs01_00181827 predicted 232
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001071777 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207452 predicted 671
2 SASI_Rn02_00207453 predicted 664
3 SASI_Rn02_00207454 predicted 749
4 SASI_Rn02_00207455 predicted 298
5 SASI_Rn02_00207456 predicted 625
6 SASI_Rn02_00207457 predicted 527
7 SASI_Rn02_00207458 predicted 748
8 SASI_Rn02_00207459 predicted 722
9 SASI_Rn02_00207460 predicted 528
10 SASI_Rn02_00207461 predicted 492
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025381 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173908 predicted 1489
2 SASI_Mm01_00173909 predicted 287
3 SASI_Mm02_00287855 predicted 944
4 SASI_Mm02_00287856 predicted 713
5 SASI_Mm01_00173910 predicted 441
6 SASI_Mm01_00173912 predicted 1305
7 SASI_Mm01_00173913 predicted 787
8 SASI_Mm01_00173914 predicted 883
9 SASI_Mm01_00173915 predicted 1397
10 SASI_Mm01_00173916 predicted 1285
11 SASI_Mm01_00173911 predicted 451
12 SASI_Mm01_00173917 predicted 582
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005291
GPR17 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 17
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005291.2-594s21c1
Sequence:CCGGTCCTGGCTTTAGTTGGCAATACTCGAGTATTGCCAACTAAAGCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005291.2-1165s21c1
Sequence:CCGGAGTGCGCATGATCGCCATAGTCTCGAGACTATGGCGATCATGCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005291.2-1594s21c1
Sequence:CCGGTCAGCAGATGCCCACCATTTCCTCGAGGAAATGGTGGGCATCTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005291.2-1621s21c1
Sequence:CCGGTCGCCTAGTCTCAACCCATAACTCGAGTTATGGGTTGAGACTAGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005291.1-1314s1c1
Sequence:CCGGCGCCTAGTCTCAACCCATAAACTCGAGTTTATGGGTTGAGACTAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005291.1-153s1c1
Sequence:CCGGCAAAGCATGAATGGCCTTGAACTCGAGTTCAAGGCCATTCATGCTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005291.1-262s1c1
Sequence:CCGGCCTCCTTCTACCTTCTGGATTCTCGAGAATCCAGAAGGTAGAAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005291.1-855s1c1
Sequence:CCGGGCAGTGCGCATGATCGCCATACTCGAGTATGGCGATCATGCGCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005291.1-354s1c1
Sequence:CCGGGCCAACGTGTTCCTGATGCATCTCGAGATGCATCAGGAACACGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005291
GPR17 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 17
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005291.2-594s21c1
Sequence:CCGGTCCTGGCTTTAGTTGGCAATACTCGAGTATTGCCAACTAAAGCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005291.2-1165s21c1
Sequence:CCGGAGTGCGCATGATCGCCATAGTCTCGAGACTATGGCGATCATGCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005291.2-1594s21c1
Sequence:CCGGTCAGCAGATGCCCACCATTTCCTCGAGGAAATGGTGGGCATCTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005291.2-1621s21c1
Sequence:CCGGTCGCCTAGTCTCAACCCATAACTCGAGTTATGGGTTGAGACTAGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005291.1-1314s1c1
Sequence:CCGGCGCCTAGTCTCAACCCATAAACTCGAGTTTATGGGTTGAGACTAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005291.1-153s1c1
Sequence:CCGGCAAAGCATGAATGGCCTTGAACTCGAGTTCAAGGCCATTCATGCTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005291.1-262s1c1
Sequence:CCGGCCTCCTTCTACCTTCTGGATTCTCGAGAATCCAGAAGGTAGAAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005291.1-855s1c1
Sequence:CCGGGCAGTGCGCATGATCGCCATACTCGAGTATGGCGATCATGCGCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005291.1-354s1c1
Sequence:CCGGGCCAACGTGTTCCTGATGCATCTCGAGATGCATCAGGAACACGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005291
GPR17 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 17
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005291.2-594s21c1
Sequence:CCGGTCCTGGCTTTAGTTGGCAATACTCGAGTATTGCCAACTAAAGCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005291.2-1165s21c1
Sequence:CCGGAGTGCGCATGATCGCCATAGTCTCGAGACTATGGCGATCATGCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005291.2-1594s21c1
Sequence:CCGGTCAGCAGATGCCCACCATTTCCTCGAGGAAATGGTGGGCATCTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005291.2-1621s21c1
Sequence:CCGGTCGCCTAGTCTCAACCCATAACTCGAGTTATGGGTTGAGACTAGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005291.1-1314s1c1
Sequence:CCGGCGCCTAGTCTCAACCCATAAACTCGAGTTTATGGGTTGAGACTAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005291.1-153s1c1
Sequence:CCGGCAAAGCATGAATGGCCTTGAACTCGAGTTCAAGGCCATTCATGCTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005291.1-262s1c1
Sequence:CCGGCCTCCTTCTACCTTCTGGATTCTCGAGAATCCAGAAGGTAGAAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005291.1-855s1c1
Sequence:CCGGGCAGTGCGCATGATCGCCATACTCGAGTATGGCGATCATGCGCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005291.1-354s1c1
Sequence:CCGGGCCAACGTGTTCCTGATGCATCTCGAGATGCATCAGGAACACGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025381
GPR17 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 17
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124054    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025381.1-4512s1c1
Sequence:CCGGCCTCCCTTAAAGATTTGCTTTCTCGAGAAAGCAAATCTTTAAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025381.1-442s1c1
Sequence:CCGGCGGTTGGTTTATCACTTCTCTCTCGAGAGAGAAGTGATAAACCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025381.1-852s1c1
Sequence:CCGGCCGGATAGAGAAGCACCTCAACTCGAGTTGAGGTGCTTCTCTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025381.1-300s1c1
Sequence:CCGGTCTGGACTTCATCCTCGCTTTCTCGAGAAAGCGAGGATGAAGTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025381.1-1060s1c1
Sequence:CCGGGATCCTGTCATGTACTTCTTTCTCGAGAAAGAAGTACATGACAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025381
GPR17 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 17
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124054    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025381.1-4512s1c1
Sequence:CCGGCCTCCCTTAAAGATTTGCTTTCTCGAGAAAGCAAATCTTTAAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025381.1-442s1c1
Sequence:CCGGCGGTTGGTTTATCACTTCTCTCTCGAGAGAGAAGTGATAAACCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025381.1-852s1c1
Sequence:CCGGCCGGATAGAGAAGCACCTCAACTCGAGTTGAGGTGCTTCTCTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025381.1-300s1c1
Sequence:CCGGTCTGGACTTCATCCTCGCTTTCTCGAGAAAGCGAGGATGAAGTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025381.1-1060s1c1
Sequence:CCGGGATCCTGTCATGTACTTCTTTCTCGAGAAAGAAGTACATGACAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025381
GPR17 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 17
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124054    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025381.1-4512s1c1
Sequence:CCGGCCTCCCTTAAAGATTTGCTTTCTCGAGAAAGCAAATCTTTAAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025381.1-442s1c1
Sequence:CCGGCGGTTGGTTTATCACTTCTCTCTCGAGAGAGAAGTGATAAACCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025381.1-852s1c1
Sequence:CCGGCCGGATAGAGAAGCACCTCAACTCGAGTTGAGGTGCTTCTCTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025381.1-300s1c1
Sequence:CCGGTCTGGACTTCATCCTCGCTTTCTCGAGAAAGCGAGGATGAAGTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025381.1-1060s1c1
Sequence:CCGGGATCCTGTCATGTACTTCTTTCTCGAGAAAGAAGTACATGACAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks