EMAIL THIS PAGE TO A FRIEND

GPR180

G protein-coupled receptor 180

147 Gene Product Result for
Synonyms: ITR
UniProtKB ID: Q86V85, A8K1D5
Gene ID:
Human(160897) Summary: This gene encodes a protein that is a member of the G protein-coupled receptor superfamily. This protein is produced predominantly in vascular smooth muscle cells and may play an important role in the regulation of vascular remodeling. [provided by RefSeq, Jul 2008]
Mouse(58245) G protein-coupled receptor 180
Rat(306165) G protein-coupled receptor 180
sheep(101106020) G protein-coupled receptor 180
domestic guinea pig(100728181) G protein-coupled receptor 180
naked mole-rat(101703373) G protein-coupled receptor 180
chicken(418792) G protein-coupled receptor 180
dog(485522) G protein-coupled receptor 180
domestic cat(101095631) G protein-coupled receptor 180
cow(537630) G protein-coupled receptor 180
Horse(100059006) G protein-coupled receptor 180
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021434 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021434 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021434 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_180989 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_180989 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_180989 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_180989 Rosetta Predictions human pricing
NM_001006994 Rosetta Predictions rat pricing
NM_021434 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_180989 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054922 predicted 361
2 SASI_Hs01_00054923 predicted 1022
3 SASI_Hs01_00054924 predicted 824
4 SASI_Hs01_00054925 predicted 860
5 SASI_Hs01_00054926 predicted 1044
6 SASI_Hs02_00369921 predicted 760
7 SASI_Hs01_00054927 predicted 478
8 SASI_Hs01_00054928 predicted 1225
9 SASI_Hs01_00054929 predicted 376
10 SASI_Hs01_00054930 predicted 1072
11 SASI_Hs01_00054931 predicted 1059
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006994 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098568 predicted 1165
2 SASI_Rn01_00098569 predicted 1329
3 SASI_Rn01_00098570 predicted 1325
4 SASI_Rn01_00098571 predicted 984
5 SASI_Rn01_00098572 predicted 1068
6 SASI_Rn01_00098573 predicted 883
7 SASI_Rn01_00098574 predicted 1159
8 SASI_Rn01_00098575 predicted 315
9 SASI_Rn01_00098576 predicted 1210
10 SASI_Rn01_00098577 predicted 560
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021434 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030707 predicted 1155
2 SASI_Mm01_00030708 predicted 1377
3 SASI_Mm01_00030709 predicted 1503
4 SASI_Mm01_00030710 predicted 1464
5 SASI_Mm01_00030711 predicted 591
6 SASI_Mm01_00030712 predicted 1518
7 SASI_Mm01_00030713 predicted 1184
8 SASI_Mm01_00030714 predicted 1368
9 SASI_Mm02_00326077 predicted 1235
10 SASI_Mm01_00030715 predicted 1662
11 SASI_Mm01_00030716 predicted 1017
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021434
GPR180 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 180
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124894    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021434.2-2354s1c1
Sequence:CCGGGCCATCTTGAATCCTTTGTAACTCGAGTTACAAAGGATTCAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021434.2-699s1c1
Sequence:CCGGCTTAGCTAATTACATCCACTTCTCGAGAAGTGGATGTAATTAGCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021434.2-918s1c1
Sequence:CCGGCATCGTCATCACACAGAGCATCTCGAGATGCTCTGTGTGATGACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021434.2-1098s1c1
Sequence:CCGGGAGAGAGTTCTACATCACGTTCTCGAGAACGTGATGTAGAACTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021434.2-789s1c1
Sequence:CCGGCTCCCAAATTCAGATGCTGTACTCGAGTACAGCATCTGAATTTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354104    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021434.5-2384s21c1
Sequence:CCGGGCCATCTTGAATCCTTTGTAACTCGAGTTACAAAGGATTCAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021434.5-948s21c1
Sequence:CCGGCATCGTCATCACACAGAGCATCTCGAGATGCTCTGTGTGATGACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021434.5-1128s21c1
Sequence:CCGGGAGAGAGTTCTACATCACGTTCTCGAGAACGTGATGTAGAACTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021434.5-729s21c1
Sequence:CCGGCTTAGCTAATTACATCCACTTCTCGAGAAGTGGATGTAATTAGCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021434.5-819s21c1
Sequence:CCGGCTCCCAAATTCAGATGCTGTACTCGAGTACAGCATCTGAATTTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021434
GPR180 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 180
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124894    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021434.2-2354s1c1
Sequence:CCGGGCCATCTTGAATCCTTTGTAACTCGAGTTACAAAGGATTCAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021434.2-699s1c1
Sequence:CCGGCTTAGCTAATTACATCCACTTCTCGAGAAGTGGATGTAATTAGCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021434.2-918s1c1
Sequence:CCGGCATCGTCATCACACAGAGCATCTCGAGATGCTCTGTGTGATGACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021434.2-1098s1c1
Sequence:CCGGGAGAGAGTTCTACATCACGTTCTCGAGAACGTGATGTAGAACTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021434.2-789s1c1
Sequence:CCGGCTCCCAAATTCAGATGCTGTACTCGAGTACAGCATCTGAATTTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354104    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021434.5-2384s21c1
Sequence:CCGGGCCATCTTGAATCCTTTGTAACTCGAGTTACAAAGGATTCAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021434.5-948s21c1
Sequence:CCGGCATCGTCATCACACAGAGCATCTCGAGATGCTCTGTGTGATGACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021434.5-1128s21c1
Sequence:CCGGGAGAGAGTTCTACATCACGTTCTCGAGAACGTGATGTAGAACTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021434.5-729s21c1
Sequence:CCGGCTTAGCTAATTACATCCACTTCTCGAGAAGTGGATGTAATTAGCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021434.5-819s21c1
Sequence:CCGGCTCCCAAATTCAGATGCTGTACTCGAGTACAGCATCTGAATTTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021434
GPR180 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 180
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124894    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021434.2-2354s1c1
Sequence:CCGGGCCATCTTGAATCCTTTGTAACTCGAGTTACAAAGGATTCAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021434.2-699s1c1
Sequence:CCGGCTTAGCTAATTACATCCACTTCTCGAGAAGTGGATGTAATTAGCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021434.2-918s1c1
Sequence:CCGGCATCGTCATCACACAGAGCATCTCGAGATGCTCTGTGTGATGACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021434.2-1098s1c1
Sequence:CCGGGAGAGAGTTCTACATCACGTTCTCGAGAACGTGATGTAGAACTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021434.2-789s1c1
Sequence:CCGGCTCCCAAATTCAGATGCTGTACTCGAGTACAGCATCTGAATTTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354104    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021434.5-2384s21c1
Sequence:CCGGGCCATCTTGAATCCTTTGTAACTCGAGTTACAAAGGATTCAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021434.5-948s21c1
Sequence:CCGGCATCGTCATCACACAGAGCATCTCGAGATGCTCTGTGTGATGACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021434.5-1128s21c1
Sequence:CCGGGAGAGAGTTCTACATCACGTTCTCGAGAACGTGATGTAGAACTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021434.5-729s21c1
Sequence:CCGGCTTAGCTAATTACATCCACTTCTCGAGAAGTGGATGTAATTAGCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021434.5-819s21c1
Sequence:CCGGCTCCCAAATTCAGATGCTGTACTCGAGTACAGCATCTGAATTTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_180989
VALIDATED
GPR180 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 180
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180989.3-773s1c1
Sequence:CCGGGCTTCCCAAATTCAGATGTTACTCGAGTAACATCTGAATTTGGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_180989.3-488s1c1
Sequence:CCGGGCCGAAGGGAATCCATTTGATCTCGAGATCAAATGGATTCCCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180989.3-1009s1c1
Sequence:CCGGTCTAAGAATTTGCCTAGCATTCTCGAGAATGCTAGGCAAATTCTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180989.3-1259s1c1
Sequence:CCGGCACAGTCTATACTGGGAAGTTCTCGAGAACTTCCCAGTATAGACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_180989.3-230s1c1
Sequence:CCGGGCTAAACTCTACCTGTTCCAACTCGAGTTGGAACAGGTAGAGTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_180989.4-1729s21c1
Sequence:CCGGACTCAGGTTTAATAGTCTTATCTCGAGATAAGACTATTAAACCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_180989.4-388s21c1
Sequence:CCGGATGAACCAGACCGAACATAATCTCGAGATTATGTTCGGTCTGGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_180989.4-283s21c1
Sequence:CCGGGCTAAACTCTACCTGTTCCAACTCGAGTTGGAACAGGTAGAGTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_180989.4-541s21c1
Sequence:CCGGGCCGAAGGGAATCCATTTGATCTCGAGATCAAATGGATTCCCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_180989.4-729s21c1
Sequence:CCGGTGGTTCAGCTTTAGCTAATTACTCGAGTAATTAGCTAAAGCTGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_180989
VALIDATED
GPR180 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 180
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180989.3-773s1c1
Sequence:CCGGGCTTCCCAAATTCAGATGTTACTCGAGTAACATCTGAATTTGGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_180989.3-488s1c1
Sequence:CCGGGCCGAAGGGAATCCATTTGATCTCGAGATCAAATGGATTCCCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180989.3-1009s1c1
Sequence:CCGGTCTAAGAATTTGCCTAGCATTCTCGAGAATGCTAGGCAAATTCTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180989.3-1259s1c1
Sequence:CCGGCACAGTCTATACTGGGAAGTTCTCGAGAACTTCCCAGTATAGACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_180989.3-230s1c1
Sequence:CCGGGCTAAACTCTACCTGTTCCAACTCGAGTTGGAACAGGTAGAGTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_180989.4-1729s21c1
Sequence:CCGGACTCAGGTTTAATAGTCTTATCTCGAGATAAGACTATTAAACCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_180989.4-388s21c1
Sequence:CCGGATGAACCAGACCGAACATAATCTCGAGATTATGTTCGGTCTGGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_180989.4-283s21c1
Sequence:CCGGGCTAAACTCTACCTGTTCCAACTCGAGTTGGAACAGGTAGAGTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_180989.4-541s21c1
Sequence:CCGGGCCGAAGGGAATCCATTTGATCTCGAGATCAAATGGATTCCCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_180989.4-729s21c1
Sequence:CCGGTGGTTCAGCTTTAGCTAATTACTCGAGTAATTAGCTAAAGCTGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_180989
VALIDATED
GPR180 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 180
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180989.3-773s1c1
Sequence:CCGGGCTTCCCAAATTCAGATGTTACTCGAGTAACATCTGAATTTGGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_180989.3-488s1c1
Sequence:CCGGGCCGAAGGGAATCCATTTGATCTCGAGATCAAATGGATTCCCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180989.3-1009s1c1
Sequence:CCGGTCTAAGAATTTGCCTAGCATTCTCGAGAATGCTAGGCAAATTCTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180989.3-1259s1c1
Sequence:CCGGCACAGTCTATACTGGGAAGTTCTCGAGAACTTCCCAGTATAGACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_180989.3-230s1c1
Sequence:CCGGGCTAAACTCTACCTGTTCCAACTCGAGTTGGAACAGGTAGAGTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_180989.4-1729s21c1
Sequence:CCGGACTCAGGTTTAATAGTCTTATCTCGAGATAAGACTATTAAACCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_180989.4-388s21c1
Sequence:CCGGATGAACCAGACCGAACATAATCTCGAGATTATGTTCGGTCTGGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_180989.4-283s21c1
Sequence:CCGGGCTAAACTCTACCTGTTCCAACTCGAGTTGGAACAGGTAGAGTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_180989.4-541s21c1
Sequence:CCGGGCCGAAGGGAATCCATTTGATCTCGAGATCAAATGGATTCCCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_180989.4-729s21c1
Sequence:CCGGTGGTTCAGCTTTAGCTAATTACTCGAGTAATTAGCTAAAGCTGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks