EMAIL THIS PAGE TO A FRIEND

GPR183

G protein-coupled receptor 183

51 Gene Product Result for
Synonyms: EBI2
UniProtKB ID: P32249, B2R8N5, Q53F99, Q5JUH7
Gene ID:
Human(1880) Summary: This gene was identified by the up-regulation of its expression upon Epstein-Barr virus infection of primary B lymphocytes. This gene is predicted to encode a G protein-coupled receptor that is most closely related to the thrombin receptor. Expression of this gene was detected in B-lymphocyte cell lines and lymphoid tissues but not in T-lymphocyte cell lines or peripheral blood T lymphocytes. The function of this gene is unknown. [provided by RefSeq, Jul 2008]
Mouse(321019) G protein-coupled receptor 183
Rat(679975) G protein-coupled receptor 183
naked mole-rat(101725210) G protein-coupled receptor 183
Zebrafish(556770) G protein-coupled receptor 183
chicken(769212) G protein-coupled receptor 183
cow(540287) G protein-coupled receptor 183
cow(615640) G protein-coupled receptor 183
Horse(100050745) G protein-coupled receptor 183
domestic cat(101101025) G protein-coupled receptor 183
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183031 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183031 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183031 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004951 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004951 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004951 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004951 Rosetta Predictions human pricing
NM_001109386 Rosetta Predictions rat pricing
NM_183031 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004951 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090933 predicted 426
2 SASI_Hs02_00338628 predicted 210
3 SASI_Hs01_00090934 predicted 380
4 SASI_Hs01_00090935 predicted 573
5 SASI_Hs02_00338629 predicted 569
6 SASI_Hs01_00090936 predicted 659
7 SASI_Hs01_00090937 predicted 615
8 SASI_Hs01_00090938 predicted 650
9 SASI_Hs01_00090939 predicted 486
10 SASI_Hs01_00090940 predicted 369
11 SASI_Hs01_00090941 predicted 397
12 SASI_Hs01_00090942 predicted 334
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109386 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247906 predicted 817
2 SASI_Rn02_00247907 predicted 991
3 SASI_Rn02_00247908 predicted 818
4 SASI_Rn02_00247909 predicted 975
5 SASI_Rn02_00247910 predicted 1283
6 SASI_Rn02_00247911 predicted 763
7 SASI_Rn02_00247912 predicted 1085
8 SASI_Rn02_00247913 predicted 716
9 SASI_Rn02_00247914 predicted 591
10 SASI_Rn02_00247915 predicted 1002
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183031 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150795 predicted 937
2 SASI_Mm01_00150796 predicted 691
3 SASI_Mm01_00150797 predicted 774
4 SASI_Mm01_00150798 predicted 1083
5 SASI_Mm01_00150799 predicted 935
6 SASI_Mm01_00150800 predicted 775
7 SASI_Mm01_00150802 predicted 792
8 SASI_Mm01_00150803 predicted 847
9 SASI_Mm01_00150804 predicted 1078
10 SASI_Mm02_00350036 predicted 877
11 SASI_Mm01_00150801 predicted 788
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183031
GPR183 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 183
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183031.1-847s1c1
Sequence:CCGGGCCATCATTCAGCACATGATACTCGAGTATCATGTGCTGAATGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183031.1-970s1c1
Sequence:CCGGGACCCGTTCATATACTTCTTTCTCGAGAAAGAAGTATATGAACGGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183031.1-264s1c1
Sequence:CCGGCTATTCAATGAACTTGGTCATCTCGAGATGACCAAGTTCATTGAATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183031.1-789s1c1
Sequence:CCGGCAACACAATTATCCTCATCATCTCGAGATGATGAGGATAATTGTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183031.1-466s1c1
Sequence:CCGGCCTCTGCGCTACAACAAGATTCTCGAGAATCTTGTTGTAGCGCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183031.2-233s1c1
Sequence:CCGGACAGCACAGCCAGGGTATTAACTCGAGTTAATACCCTGGCTGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183031.2-192s1c1
Sequence:CCGGGGCAACGTCTCATGGCAATAACTCGAGTTATTGCCATGAGACGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183031.2-1221s1c1
Sequence:CCGGGGCCTCCAATGGAAGGTAAAGCTCGAGCTTTACCTTCCATTGGAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219436    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183031.2-266s1c1
Sequence:CCGGACAGCCTGGTCTTCATCATTGCTCGAGCAATGATGAAGACCAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183031.2-621s1c1
Sequence:CCGGGATTCTGGTCTTTGCTCAAACCTCGAGGTTTGAGCAAAGACCAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183031.2-1106s1c1
Sequence:CCGGAGGTCATGAAGATGCTCAAACCTCGAGGTTTGAGCATCTTCATGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219433    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183031.2-695s1c1
Sequence:CCGGGCATGGAGTATCCAAACTTTGCTCGAGCAAAGTTTGGATACTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183031.2-407s1c1
Sequence:CCGGCCACTCGGATAGCCTACTATGCTCGAGCATAGTAGGCTATCCGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219429    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183031.2-2749s1c1
Sequence:CCGGAGGCTACCCTGCAACTCATTTCTCGAGAAATGAGTTGCAGGGTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219428    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183031.2-2634s1c1
Sequence:CCGGACTATACTATGAGCCATAATTCTCGAGAATTATGGCTCATAGTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183031
GPR183 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 183
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183031.1-847s1c1
Sequence:CCGGGCCATCATTCAGCACATGATACTCGAGTATCATGTGCTGAATGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183031.1-970s1c1
Sequence:CCGGGACCCGTTCATATACTTCTTTCTCGAGAAAGAAGTATATGAACGGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183031.1-264s1c1
Sequence:CCGGCTATTCAATGAACTTGGTCATCTCGAGATGACCAAGTTCATTGAATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183031.1-789s1c1
Sequence:CCGGCAACACAATTATCCTCATCATCTCGAGATGATGAGGATAATTGTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183031.1-466s1c1
Sequence:CCGGCCTCTGCGCTACAACAAGATTCTCGAGAATCTTGTTGTAGCGCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183031.2-233s1c1
Sequence:CCGGACAGCACAGCCAGGGTATTAACTCGAGTTAATACCCTGGCTGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183031.2-192s1c1
Sequence:CCGGGGCAACGTCTCATGGCAATAACTCGAGTTATTGCCATGAGACGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183031.2-1221s1c1
Sequence:CCGGGGCCTCCAATGGAAGGTAAAGCTCGAGCTTTACCTTCCATTGGAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219436    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183031.2-266s1c1
Sequence:CCGGACAGCCTGGTCTTCATCATTGCTCGAGCAATGATGAAGACCAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183031.2-621s1c1
Sequence:CCGGGATTCTGGTCTTTGCTCAAACCTCGAGGTTTGAGCAAAGACCAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183031.2-1106s1c1
Sequence:CCGGAGGTCATGAAGATGCTCAAACCTCGAGGTTTGAGCATCTTCATGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219433    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183031.2-695s1c1
Sequence:CCGGGCATGGAGTATCCAAACTTTGCTCGAGCAAAGTTTGGATACTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183031.2-407s1c1
Sequence:CCGGCCACTCGGATAGCCTACTATGCTCGAGCATAGTAGGCTATCCGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219429    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183031.2-2749s1c1
Sequence:CCGGAGGCTACCCTGCAACTCATTTCTCGAGAAATGAGTTGCAGGGTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219428    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183031.2-2634s1c1
Sequence:CCGGACTATACTATGAGCCATAATTCTCGAGAATTATGGCTCATAGTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183031
GPR183 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 183
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183031.1-847s1c1
Sequence:CCGGGCCATCATTCAGCACATGATACTCGAGTATCATGTGCTGAATGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183031.1-970s1c1
Sequence:CCGGGACCCGTTCATATACTTCTTTCTCGAGAAAGAAGTATATGAACGGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183031.1-264s1c1
Sequence:CCGGCTATTCAATGAACTTGGTCATCTCGAGATGACCAAGTTCATTGAATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183031.1-789s1c1
Sequence:CCGGCAACACAATTATCCTCATCATCTCGAGATGATGAGGATAATTGTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183031.1-466s1c1
Sequence:CCGGCCTCTGCGCTACAACAAGATTCTCGAGAATCTTGTTGTAGCGCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183031.2-233s1c1
Sequence:CCGGACAGCACAGCCAGGGTATTAACTCGAGTTAATACCCTGGCTGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183031.2-192s1c1
Sequence:CCGGGGCAACGTCTCATGGCAATAACTCGAGTTATTGCCATGAGACGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183031.2-1221s1c1
Sequence:CCGGGGCCTCCAATGGAAGGTAAAGCTCGAGCTTTACCTTCCATTGGAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219436    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183031.2-266s1c1
Sequence:CCGGACAGCCTGGTCTTCATCATTGCTCGAGCAATGATGAAGACCAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183031.2-621s1c1
Sequence:CCGGGATTCTGGTCTTTGCTCAAACCTCGAGGTTTGAGCAAAGACCAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183031.2-1106s1c1
Sequence:CCGGAGGTCATGAAGATGCTCAAACCTCGAGGTTTGAGCATCTTCATGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219433    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183031.2-695s1c1
Sequence:CCGGGCATGGAGTATCCAAACTTTGCTCGAGCAAAGTTTGGATACTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183031.2-407s1c1
Sequence:CCGGCCACTCGGATAGCCTACTATGCTCGAGCATAGTAGGCTATCCGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219429    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183031.2-2749s1c1
Sequence:CCGGAGGCTACCCTGCAACTCATTTCTCGAGAAATGAGTTGCAGGGTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219428    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183031.2-2634s1c1
Sequence:CCGGACTATACTATGAGCCATAATTCTCGAGAATTATGGCTCATAGTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004951
GPR183 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 183
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011354    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004951.2-1290s1c1
Sequence:CCGGGCAAACAACATAAAGCACAATCTCGAGATTGTGCTTTATGTTGTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004951.2-171s1c1
Sequence:CCGGCGTGGGAAACTTACTAGCCTTCTCGAGAAGGCTAGTAAGTTTCCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004951.2-405s1c1
Sequence:CCGGCCTGAGTATTGACCGCTTCATCTCGAGATGAAGCGGTCAATACTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004951.2-876s1c1
Sequence:CCGGCCAAAGACATTCGTTCCAGATCTCGAGATCTGGAACGAATGTCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004951.2-285s1c1
Sequence:CCGGGCCTACACGAATAGCCTACTACTCGAGTAGTAGGCTATTCGTGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004951.4-255s21c1
Sequence:CCGGCAGCACGGCCAGGATAGTAATCTCGAGATTACTATCCTGGCCGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004951.4-323s21c1
Sequence:CCGGTACTAGCCTTGGTCGTCATTGCTCGAGCAATGACGACCAAGGCTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004951.4-1308s21c1
Sequence:CCGGTTGCAGGACTTCCCTTATAAACTCGAGTTTATAAGGGAAGTCCTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004951.4-418s21c1
Sequence:CCGGACCGCTTTGCCTACACGAATACTCGAGTATTCGTGTAGGCAAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004951
GPR183 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 183
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011354    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004951.2-1290s1c1
Sequence:CCGGGCAAACAACATAAAGCACAATCTCGAGATTGTGCTTTATGTTGTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004951.2-171s1c1
Sequence:CCGGCGTGGGAAACTTACTAGCCTTCTCGAGAAGGCTAGTAAGTTTCCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004951.2-405s1c1
Sequence:CCGGCCTGAGTATTGACCGCTTCATCTCGAGATGAAGCGGTCAATACTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004951.2-876s1c1
Sequence:CCGGCCAAAGACATTCGTTCCAGATCTCGAGATCTGGAACGAATGTCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004951.2-285s1c1
Sequence:CCGGGCCTACACGAATAGCCTACTACTCGAGTAGTAGGCTATTCGTGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004951.4-255s21c1
Sequence:CCGGCAGCACGGCCAGGATAGTAATCTCGAGATTACTATCCTGGCCGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004951.4-323s21c1
Sequence:CCGGTACTAGCCTTGGTCGTCATTGCTCGAGCAATGACGACCAAGGCTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004951.4-1308s21c1
Sequence:CCGGTTGCAGGACTTCCCTTATAAACTCGAGTTTATAAGGGAAGTCCTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004951.4-418s21c1
Sequence:CCGGACCGCTTTGCCTACACGAATACTCGAGTATTCGTGTAGGCAAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004951
GPR183 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 183
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011354    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004951.2-1290s1c1
Sequence:CCGGGCAAACAACATAAAGCACAATCTCGAGATTGTGCTTTATGTTGTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004951.2-171s1c1
Sequence:CCGGCGTGGGAAACTTACTAGCCTTCTCGAGAAGGCTAGTAAGTTTCCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004951.2-405s1c1
Sequence:CCGGCCTGAGTATTGACCGCTTCATCTCGAGATGAAGCGGTCAATACTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004951.2-876s1c1
Sequence:CCGGCCAAAGACATTCGTTCCAGATCTCGAGATCTGGAACGAATGTCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004951.2-285s1c1
Sequence:CCGGGCCTACACGAATAGCCTACTACTCGAGTAGTAGGCTATTCGTGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004951.4-255s21c1
Sequence:CCGGCAGCACGGCCAGGATAGTAATCTCGAGATTACTATCCTGGCCGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004951.4-323s21c1
Sequence:CCGGTACTAGCCTTGGTCGTCATTGCTCGAGCAATGACGACCAAGGCTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004951.4-1308s21c1
Sequence:CCGGTTGCAGGACTTCCCTTATAAACTCGAGTTTATAAGGGAAGTCCTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004951.4-418s21c1
Sequence:CCGGACCGCTTTGCCTACACGAATACTCGAGTATTCGTGTAGGCAAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks