EMAIL THIS PAGE TO A FRIEND

GPR18

G protein-coupled receptor 18

69 Gene Product Result for
UniProtKB ID: Q14330, Q6GTM3, Q96HI6, Q9H2L2
Gene ID:
Mouse(110168) G protein-coupled receptor 18
Rat(679957) G protein-coupled receptor 18
Zebrafish(556711) G protein-coupled receptor 18
chicken(100858263) G protein-coupled receptor 18
dog(485531) G protein-coupled receptor 18
cow(540038) G protein-coupled receptor 18
domestic cat(101101282) G protein-coupled receptor 18
domestic guinea pig(100724695) G protein-coupled receptor 18
naked mole-rat(101715147) G protein-coupled receptor 18
sheep(101111202) G protein-coupled receptor 18
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182806 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_182806 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_182806 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005292 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005292 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005292 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU090431 MISSION® esiRNA esiRNA human GPR18 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098200 Rosetta Predictions human pricing
NM_005292 Rosetta Predictions human pricing
NM_001079710 Rosetta Predictions rat pricing
NM_182806 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098200 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318618 predicted 467
2 SASI_Hs02_00318619 predicted 573
3 SASI_Hs02_00318620 predicted 477
4 SASI_Hs02_00318621 predicted 522
5 SASI_Hs02_00318622 predicted 495
6 SASI_Hs02_00318623 predicted 1116
7 SASI_Hs02_00318624 predicted 1138
8 SASI_Hs02_00318625 predicted 492
9 SASI_Hs02_00318626 predicted 577
10 SASI_Hs02_00318627 predicted 591
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005292 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182670 predicted 661
2 SASI_Hs01_00182671 predicted 762
3 SASI_Hs02_00339340 predicted 816
4 SASI_Hs02_00339341 predicted 662
5 SASI_Hs01_00182673 predicted 693
6 SASI_Hs01_00182674 predicted 1304
7 SASI_Hs02_00339342 predicted 685
8 SASI_Hs02_00339343 predicted 1330
9 SASI_Hs02_00339344 predicted 776
10 SASI_Hs02_00339345 predicted 754
11 SASI_Hs01_00182668 predicted 492
12 SASI_Hs01_00182669 predicted 535
13 SASI_Hs01_00182672 predicted 625
14 SASI_Hs01_00182675 predicted 542
15 SASI_Hs01_00182676 predicted 604
16 SASI_Hs01_00182677 predicted 633
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079710 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208099 predicted 870
2 SASI_Rn02_00208100 predicted 578
3 SASI_Rn02_00208101 predicted 826
4 SASI_Rn02_00208102 predicted 831
5 SASI_Rn02_00208103 predicted 315
6 SASI_Rn02_00208104 predicted 1065
7 SASI_Rn02_00208105 predicted 480
8 SASI_Rn02_00208106 predicted 542
9 SASI_Rn02_00208107 predicted 547
10 SASI_Rn02_00208108 predicted 1049
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182806 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156764 predicted 978
2 SASI_Mm01_00156765 predicted 292
3 SASI_Mm01_00156766 predicted 742
4 SASI_Mm01_00156767 predicted 1041
5 SASI_Mm01_00156769 predicted 657
6 SASI_Mm01_00156770 predicted 323
7 SASI_Mm02_00349974 predicted 252
8 SASI_Mm01_00156771 predicted 393
9 SASI_Mm01_00156772 predicted 296
10 SASI_Mm01_00156773 predicted 1026
11 SASI_Mm01_00156768 predicted 233
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182806
GPR18 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 18
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182806.1-1072s21c1
Sequence:CCGGAGTGTCCGATCGGGCAGTTTACTCGAGTAAACTGCCCGATCGGACACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182806.1-746s21c1
Sequence:CCGGGGTGCTACGTGGTCATCATTCCTCGAGGAATGATGACCACGTAGCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182806.1-336s1c1
Sequence:CCGGCCTCGTATTTATACTCAGTCTCTCGAGAGACTGAGTATAAATACGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182806.1-1042s1c1
Sequence:CCGGCGCAATTACCTTCGCAGTGTTCTCGAGAACACTGCGAAGGTAATTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182806.1-458s1c1
Sequence:CCGGTGTGGCTTCTTGCTTTCATTACTCGAGTAATGAAAGCAAGAAGCCACATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182806.1-984s1c1
Sequence:CCGGCCTCTACTACATCGTTTCCAACTCGAGTTGGAAACGATGTAGTAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028151    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182806.1-1142s1c1
Sequence:CCGGGCCAGTCTTCAGTCTCTTTAACTCGAGTTAAAGAGACTGAAGACTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182806
GPR18 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 18
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182806.1-1072s21c1
Sequence:CCGGAGTGTCCGATCGGGCAGTTTACTCGAGTAAACTGCCCGATCGGACACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182806.1-746s21c1
Sequence:CCGGGGTGCTACGTGGTCATCATTCCTCGAGGAATGATGACCACGTAGCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182806.1-336s1c1
Sequence:CCGGCCTCGTATTTATACTCAGTCTCTCGAGAGACTGAGTATAAATACGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182806.1-1042s1c1
Sequence:CCGGCGCAATTACCTTCGCAGTGTTCTCGAGAACACTGCGAAGGTAATTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182806.1-458s1c1
Sequence:CCGGTGTGGCTTCTTGCTTTCATTACTCGAGTAATGAAAGCAAGAAGCCACATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182806.1-984s1c1
Sequence:CCGGCCTCTACTACATCGTTTCCAACTCGAGTTGGAAACGATGTAGTAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028151    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182806.1-1142s1c1
Sequence:CCGGGCCAGTCTTCAGTCTCTTTAACTCGAGTTAAAGAGACTGAAGACTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182806
GPR18 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 18
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182806.1-1072s21c1
Sequence:CCGGAGTGTCCGATCGGGCAGTTTACTCGAGTAAACTGCCCGATCGGACACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182806.1-746s21c1
Sequence:CCGGGGTGCTACGTGGTCATCATTCCTCGAGGAATGATGACCACGTAGCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182806.1-336s1c1
Sequence:CCGGCCTCGTATTTATACTCAGTCTCTCGAGAGACTGAGTATAAATACGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182806.1-1042s1c1
Sequence:CCGGCGCAATTACCTTCGCAGTGTTCTCGAGAACACTGCGAAGGTAATTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182806.1-458s1c1
Sequence:CCGGTGTGGCTTCTTGCTTTCATTACTCGAGTAATGAAAGCAAGAAGCCACATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182806.1-984s1c1
Sequence:CCGGCCTCTACTACATCGTTTCCAACTCGAGTTGGAAACGATGTAGTAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028151    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182806.1-1142s1c1
Sequence:CCGGGCCAGTCTTCAGTCTCTTTAACTCGAGTTAAAGAGACTGAAGACTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005292
GPR18 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 18
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005292.3-694s21c1
Sequence:CCGGGCATTAGTGGACTTGATATTTCTCGAGAAATATCAAGTCCACTAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005292.3-1398s21c1
Sequence:CCGGTGTCATGCTATACCGTAATTACTCGAGTAATTACGGTATAGCATGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005292.3-1452s21c1
Sequence:CCGGTGGTAGTCTACGGTCACTAAGCTCGAGCTTAGTGACCGTAGACTACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008830    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005292.2-1455s1c1
Sequence:CCGGCTTTCATTTCAATCCCATCAACTCGAGTTGATGGGATTGAAATGAAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005292.2-796s1c1
Sequence:CCGGGCTGACAGATACATGGCCATTCTCGAGAATGGCCATGTATCTGTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005292.2-637s1c1
Sequence:CCGGGTGGCATTAGTGGACTTGATACTCGAGTATCAAGTCCACTAATGCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005292.2-909s1c1
Sequence:CCGGCCCTCTGCTACTGCTCTATAACTCGAGTTATAGAGCAGTAGCAGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005292.2-1333s1c1
Sequence:CCGGCGAGTCATTAGTGTCATGCTACTCGAGTAGCATGACACTAATGACTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005292
GPR18 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 18
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005292.3-694s21c1
Sequence:CCGGGCATTAGTGGACTTGATATTTCTCGAGAAATATCAAGTCCACTAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005292.3-1398s21c1
Sequence:CCGGTGTCATGCTATACCGTAATTACTCGAGTAATTACGGTATAGCATGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005292.3-1452s21c1
Sequence:CCGGTGGTAGTCTACGGTCACTAAGCTCGAGCTTAGTGACCGTAGACTACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008830    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005292.2-1455s1c1
Sequence:CCGGCTTTCATTTCAATCCCATCAACTCGAGTTGATGGGATTGAAATGAAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005292.2-796s1c1
Sequence:CCGGGCTGACAGATACATGGCCATTCTCGAGAATGGCCATGTATCTGTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005292.2-637s1c1
Sequence:CCGGGTGGCATTAGTGGACTTGATACTCGAGTATCAAGTCCACTAATGCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005292.2-909s1c1
Sequence:CCGGCCCTCTGCTACTGCTCTATAACTCGAGTTATAGAGCAGTAGCAGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005292.2-1333s1c1
Sequence:CCGGCGAGTCATTAGTGTCATGCTACTCGAGTAGCATGACACTAATGACTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005292
GPR18 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 18
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005292.3-694s21c1
Sequence:CCGGGCATTAGTGGACTTGATATTTCTCGAGAAATATCAAGTCCACTAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005292.3-1398s21c1
Sequence:CCGGTGTCATGCTATACCGTAATTACTCGAGTAATTACGGTATAGCATGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005292.3-1452s21c1
Sequence:CCGGTGGTAGTCTACGGTCACTAAGCTCGAGCTTAGTGACCGTAGACTACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008830    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005292.2-1455s1c1
Sequence:CCGGCTTTCATTTCAATCCCATCAACTCGAGTTGATGGGATTGAAATGAAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005292.2-796s1c1
Sequence:CCGGGCTGACAGATACATGGCCATTCTCGAGAATGGCCATGTATCTGTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005292.2-637s1c1
Sequence:CCGGGTGGCATTAGTGGACTTGATACTCGAGTATCAAGTCCACTAATGCCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005292.2-909s1c1
Sequence:CCGGCCCTCTGCTACTGCTCTATAACTCGAGTTATAGAGCAGTAGCAGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005292.2-1333s1c1
Sequence:CCGGCGAGTCATTAGTGTCATGCTACTCGAGTAGCATGACACTAATGACTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)