EMAIL THIS PAGE TO A FRIEND

GPR19

G protein-coupled receptor 19

66 Gene Product Result for
UniProtKB ID: Q15760
Gene ID:
Mouse(14760) G protein-coupled receptor 19
Rat(312787) G protein-coupled receptor 19
Zebrafish(393969) G protein-coupled receptor 19
cow(540647) G protein-coupled receptor 19
Horse(100066597) G protein-coupled receptor 19
chicken(100857747) G protein-coupled receptor 19
dog(100686071) G protein-coupled receptor 19
domestic cat(101092275) G protein-coupled receptor 19
domestic guinea pig(100729081) G protein-coupled receptor 19
naked mole-rat(101699089) G protein-coupled receptor 19
sheep(101111955) G protein-coupled receptor 19
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006143 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006143 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006143 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008157 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008157 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008157 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006143 Rosetta Predictions human pricing
NM_080579 Rosetta Predictions rat pricing
NM_008157 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006143 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340980 predicted 224
2 SASI_Hs01_00133100 predicted 695
3 SASI_Hs01_00133101 predicted 301
4 SASI_Hs02_00340981 predicted 273
5 SASI_Hs01_00133104 predicted 341
6 SASI_Hs01_00133105 predicted 634
7 SASI_Hs01_00133106 predicted 428
8 SASI_Hs01_00133107 predicted 504
9 SASI_Hs01_00133108 predicted 409
10 SASI_Hs01_00133109 predicted 813
11 SASI_Hs01_00133102 predicted 722
12 SASI_Hs01_00133103 predicted 685
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080579 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119156 predicted 809
2 SASI_Rn01_00119157 predicted 371
3 SASI_Rn01_00119158 predicted 876
4 SASI_Rn01_00119159 predicted 1133
5 SASI_Rn01_00119160 predicted 433
6 SASI_Rn01_00119161 predicted 767
7 SASI_Rn01_00119162 predicted 1207
8 SASI_Rn02_00267242 predicted 403
9 SASI_Rn01_00119163 predicted 1091
10 SASI_Rn01_00119164 predicted 848
11 SASI_Rn01_00119165 predicted 981
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008157 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062589 predicted 730
2 SASI_Mm01_00062591 predicted 849
3 SASI_Mm01_00062592 predicted 1039
4 SASI_Mm01_00062593 predicted 589
5 SASI_Mm01_00062594 predicted 773
6 SASI_Mm01_00062595 predicted 1015
7 SASI_Mm01_00062596 predicted 1013
8 SASI_Mm01_00062597 predicted 356
9 SASI_Mm02_00313261 predicted 1042
10 SASI_Mm02_00313262 predicted 673
11 SASI_Mm01_00062590 predicted 294
12 SASI_Mm01_00062598 predicted 808
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006143
GPR19 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 19
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006143.2-764s21c1
Sequence:CCGGACGTGCAAGGTTGTGCGATATCTCGAGATATCGCACAACCTTGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006143.2-1411s21c1
Sequence:CCGGTTACCGAAGCAATGCCTATACCTCGAGGTATAGGCATTGCTTCGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006143.2-906s21c1
Sequence:CCGGTTGCGGCATCGTGGATCTTTGCTCGAGCAAAGATCCACGATGCCGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006143.1-1065s1c1
Sequence:CCGGCCTCTATGAAATGTTACCGAACTCGAGTTCGGTAACATTTCATAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006143.1-509s1c1
Sequence:CCGGCGGTTCTACACCATCGTCTATCTCGAGATAGACGATGGTGTAGAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006143.1-1229s1c1
Sequence:CCGGGCTTGGCCCATTAACTCAAATCTCGAGATTTGAGTTAATGGGCCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006143.1-432s1c1
Sequence:CCGGCGTGCAAGGTTGTGCGATATTCTCGAGAATATCGCACAACCTTGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006143.1-1081s1c1
Sequence:CCGGCCGAAGCAATGCCTATACTATCTCGAGATAGTATAGGCATTGCTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006143
GPR19 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 19
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006143.2-764s21c1
Sequence:CCGGACGTGCAAGGTTGTGCGATATCTCGAGATATCGCACAACCTTGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006143.2-1411s21c1
Sequence:CCGGTTACCGAAGCAATGCCTATACCTCGAGGTATAGGCATTGCTTCGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006143.2-906s21c1
Sequence:CCGGTTGCGGCATCGTGGATCTTTGCTCGAGCAAAGATCCACGATGCCGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006143.1-1065s1c1
Sequence:CCGGCCTCTATGAAATGTTACCGAACTCGAGTTCGGTAACATTTCATAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006143.1-509s1c1
Sequence:CCGGCGGTTCTACACCATCGTCTATCTCGAGATAGACGATGGTGTAGAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006143.1-1229s1c1
Sequence:CCGGGCTTGGCCCATTAACTCAAATCTCGAGATTTGAGTTAATGGGCCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006143.1-432s1c1
Sequence:CCGGCGTGCAAGGTTGTGCGATATTCTCGAGAATATCGCACAACCTTGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006143.1-1081s1c1
Sequence:CCGGCCGAAGCAATGCCTATACTATCTCGAGATAGTATAGGCATTGCTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006143
GPR19 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 19
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006143.2-764s21c1
Sequence:CCGGACGTGCAAGGTTGTGCGATATCTCGAGATATCGCACAACCTTGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006143.2-1411s21c1
Sequence:CCGGTTACCGAAGCAATGCCTATACCTCGAGGTATAGGCATTGCTTCGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006143.2-906s21c1
Sequence:CCGGTTGCGGCATCGTGGATCTTTGCTCGAGCAAAGATCCACGATGCCGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006143.1-1065s1c1
Sequence:CCGGCCTCTATGAAATGTTACCGAACTCGAGTTCGGTAACATTTCATAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006143.1-509s1c1
Sequence:CCGGCGGTTCTACACCATCGTCTATCTCGAGATAGACGATGGTGTAGAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006143.1-1229s1c1
Sequence:CCGGGCTTGGCCCATTAACTCAAATCTCGAGATTTGAGTTAATGGGCCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006143.1-432s1c1
Sequence:CCGGCGTGCAAGGTTGTGCGATATTCTCGAGAATATCGCACAACCTTGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006143.1-1081s1c1
Sequence:CCGGCCGAAGCAATGCCTATACTATCTCGAGATAGTATAGGCATTGCTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008157
VALIDATED
GPR19 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 19
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000328127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008157.1-1109s21c1
Sequence:CCGGTCTGCATGTCCTCGATGAAATCTCGAGATTTCATCGAGGACATGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008157.1-1015s21c1
Sequence:CCGGGCAGTCACGTGGGTATCTTTCCTCGAGGAAAGATACCCACGTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008157.1-1185s21c1
Sequence:CCGGCTATGTGGGCATTTCGGAAATCTCGAGATTTCCGAAATGCCCACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008157.1-1055s21c1
Sequence:CCGGCCACTCTGTACTCTATTTATACTCGAGTATAAATAGAGTACAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008157.1-758s21c1
Sequence:CCGGTCTTGGTGGGCTTCGTGATTCCTCGAGGAATCACGAAGCCCACCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008157.1-1054s1c1
Sequence:CCGGCCCACTCTGTACTCTATTTATCTCGAGATAAATAGAGTACAGAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008157.1-909s1c1
Sequence:CCGGCCTGCTCTTGAACCTAGTGTTCTCGAGAACACTAGGTTCAAGAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008157.1-294s1c1
Sequence:CCGGCGCTTTGTGGTTGTTCTCCATCTCGAGATGGAGAACAACCACAAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008157.1-561s1c1
Sequence:CCGGCCGCTTCTATACCATCGTCTACTCGAGTAGACGATGGTATAGAAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008157.1-1022s1c1
Sequence:CCGGCGTGGGTATCTTTCAGCTCTTCTCGAGAAGAGCTGAAAGATACCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008157
VALIDATED
GPR19 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 19
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000328127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008157.1-1109s21c1
Sequence:CCGGTCTGCATGTCCTCGATGAAATCTCGAGATTTCATCGAGGACATGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008157.1-1015s21c1
Sequence:CCGGGCAGTCACGTGGGTATCTTTCCTCGAGGAAAGATACCCACGTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008157.1-1185s21c1
Sequence:CCGGCTATGTGGGCATTTCGGAAATCTCGAGATTTCCGAAATGCCCACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008157.1-1055s21c1
Sequence:CCGGCCACTCTGTACTCTATTTATACTCGAGTATAAATAGAGTACAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008157.1-758s21c1
Sequence:CCGGTCTTGGTGGGCTTCGTGATTCCTCGAGGAATCACGAAGCCCACCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008157.1-1054s1c1
Sequence:CCGGCCCACTCTGTACTCTATTTATCTCGAGATAAATAGAGTACAGAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008157.1-909s1c1
Sequence:CCGGCCTGCTCTTGAACCTAGTGTTCTCGAGAACACTAGGTTCAAGAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008157.1-294s1c1
Sequence:CCGGCGCTTTGTGGTTGTTCTCCATCTCGAGATGGAGAACAACCACAAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008157.1-561s1c1
Sequence:CCGGCCGCTTCTATACCATCGTCTACTCGAGTAGACGATGGTATAGAAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008157.1-1022s1c1
Sequence:CCGGCGTGGGTATCTTTCAGCTCTTCTCGAGAAGAGCTGAAAGATACCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008157
VALIDATED
GPR19 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 19
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000328127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008157.1-1109s21c1
Sequence:CCGGTCTGCATGTCCTCGATGAAATCTCGAGATTTCATCGAGGACATGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008157.1-1015s21c1
Sequence:CCGGGCAGTCACGTGGGTATCTTTCCTCGAGGAAAGATACCCACGTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008157.1-1185s21c1
Sequence:CCGGCTATGTGGGCATTTCGGAAATCTCGAGATTTCCGAAATGCCCACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008157.1-1055s21c1
Sequence:CCGGCCACTCTGTACTCTATTTATACTCGAGTATAAATAGAGTACAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008157.1-758s21c1
Sequence:CCGGTCTTGGTGGGCTTCGTGATTCCTCGAGGAATCACGAAGCCCACCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008157.1-1054s1c1
Sequence:CCGGCCCACTCTGTACTCTATTTATCTCGAGATAAATAGAGTACAGAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008157.1-909s1c1
Sequence:CCGGCCTGCTCTTGAACCTAGTGTTCTCGAGAACACTAGGTTCAAGAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008157.1-294s1c1
Sequence:CCGGCGCTTTGTGGTTGTTCTCCATCTCGAGATGGAGAACAACCACAAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008157.1-561s1c1
Sequence:CCGGCCGCTTCTATACCATCGTCTACTCGAGTAGACGATGGTATAGAAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008157.1-1022s1c1
Sequence:CCGGCGTGGGTATCTTTCAGCTCTTCTCGAGAAGAGCTGAAAGATACCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks