EMAIL THIS PAGE TO A FRIEND

GPR1

G protein-coupled receptor 1

UniProtKB ID: P46091, A5JUU6, A8K4L1, Q53TR9, Q6NVX4
Gene ID:
Mouse(241070) G protein-coupled receptor 1
Rat(25457) G protein-coupled receptor 1
Zebrafish(100004124) G protein-coupled receptor 1
dog(478882) G protein-coupled receptor 1
domestic cat(101101578) G protein-coupled receptor 1
Horse(100068488) G protein-coupled receptor 1
cow(509707) G protein-coupled receptor 1
chicken(424101) G protein-coupled receptor 1
sheep(101116208) G protein-coupled receptor 1
naked mole-rat(101716735) G protein-coupled receptor 1
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146250 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146250 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146250 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005279 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005279 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005279 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU157591 MISSION® esiRNA esiRNA human GPR1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098199 Rosetta Predictions human pricing
NM_005279 Rosetta Predictions human pricing
NM_012961 Rosetta Predictions rat pricing
NM_146250 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098199 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318608 predicted 1283
2 SASI_Hs02_00318609 predicted 1409
3 SASI_Hs02_00318610 predicted 1155
4 SASI_Hs02_00318611 predicted 996
5 SASI_Hs02_00318612 predicted 506
6 SASI_Hs02_00318613 predicted 786
7 SASI_Hs02_00318614 predicted 1153
8 SASI_Hs02_00318615 predicted 1282
9 SASI_Hs02_00318616 predicted 713
10 SASI_Hs02_00318617 predicted 1140
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005279 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211678 predicted 1287
2 SASI_Hs01_00211680 predicted 1418
3 SASI_Hs01_00211681 predicted 1165
4 SASI_Hs02_00339331 predicted 998
5 SASI_Hs01_00211682 predicted 502
6 SASI_Hs01_00211683 predicted 792
7 SASI_Hs01_00211684 predicted 1166
8 SASI_Hs01_00211685 predicted 1290
9 SASI_Hs01_00211686 predicted 719
10 SASI_Hs01_00211687 predicted 1144
11 SASI_Hs01_00211679 predicted 753
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012961 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042532 predicted 364
2 SASI_Rn01_00042533 predicted 541
3 SASI_Rn01_00042534 predicted 446
4 SASI_Rn01_00042535 predicted 531
5 SASI_Rn01_00042536 predicted 214
6 SASI_Rn01_00042537 predicted 715
7 SASI_Rn01_00042538 predicted 362
8 SASI_Rn01_00042539 predicted 642
9 SASI_Rn01_00042540 predicted 213
10 SASI_Rn02_00260563 predicted 787
11 SASI_Rn01_00042541 predicted 610
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146250 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112394 predicted 991
2 SASI_Mm01_00112395 predicted 967
3 SASI_Mm01_00112396 predicted 374
4 SASI_Mm01_00112397 predicted 1315
5 SASI_Mm01_00112398 predicted 461
6 SASI_Mm01_00112399 predicted 254
7 SASI_Mm01_00112400 predicted 799
8 SASI_Mm01_00112401 predicted 885
9 SASI_Mm01_00112402 predicted 1157
10 SASI_Mm01_00112403 predicted 917
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146250
GPR1 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146250.1-1128s1c1
Sequence:CCGGCGTCCTAATAAGCAAGACGTTCTCGAGAACGTCTTGCTTATTAGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146250.1-460s1c1
Sequence:CCGGGCCATCGCAGACTTCATCTTTCTCGAGAAAGATGAAGTCTGCGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146250.1-360s1c1
Sequence:CCGGCCTAGCATTTGTTCTGGGCATCTCGAGATGCCCAGAACAAATGCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146250.1-1106s1c1
Sequence:CCGGGCTGCTTGAATCCCATCCTTTCTCGAGAAAGGATGGGATTCAAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028170    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146250.1-1340s1c1
Sequence:CCGGCCTTTCAGATTAGGTTGCATTCTCGAGAATGCAACCTAATCTGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146250.1-543s21c1
Sequence:CCGGGTGGCTCTGCAAGGTTAATTCCTCGAGGAATTAACCTTGCAGAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422939    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146250.1-1420s21c1
Sequence:CCGGGATTTCTTCCCTGCAATTTAACTCGAGTTAAATTGCAGGGAAGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146250.1-266s21c1
Sequence:CCGGATTCCTATGCCTTAGATTATTCTCGAGAATAATCTAAGGCATAGGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146250
GPR1 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146250.1-1128s1c1
Sequence:CCGGCGTCCTAATAAGCAAGACGTTCTCGAGAACGTCTTGCTTATTAGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146250.1-460s1c1
Sequence:CCGGGCCATCGCAGACTTCATCTTTCTCGAGAAAGATGAAGTCTGCGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146250.1-360s1c1
Sequence:CCGGCCTAGCATTTGTTCTGGGCATCTCGAGATGCCCAGAACAAATGCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146250.1-1106s1c1
Sequence:CCGGGCTGCTTGAATCCCATCCTTTCTCGAGAAAGGATGGGATTCAAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028170    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146250.1-1340s1c1
Sequence:CCGGCCTTTCAGATTAGGTTGCATTCTCGAGAATGCAACCTAATCTGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146250.1-543s21c1
Sequence:CCGGGTGGCTCTGCAAGGTTAATTCCTCGAGGAATTAACCTTGCAGAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422939    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146250.1-1420s21c1
Sequence:CCGGGATTTCTTCCCTGCAATTTAACTCGAGTTAAATTGCAGGGAAGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146250.1-266s21c1
Sequence:CCGGATTCCTATGCCTTAGATTATTCTCGAGAATAATCTAAGGCATAGGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146250
GPR1 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146250.1-1128s1c1
Sequence:CCGGCGTCCTAATAAGCAAGACGTTCTCGAGAACGTCTTGCTTATTAGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146250.1-460s1c1
Sequence:CCGGGCCATCGCAGACTTCATCTTTCTCGAGAAAGATGAAGTCTGCGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146250.1-360s1c1
Sequence:CCGGCCTAGCATTTGTTCTGGGCATCTCGAGATGCCCAGAACAAATGCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146250.1-1106s1c1
Sequence:CCGGGCTGCTTGAATCCCATCCTTTCTCGAGAAAGGATGGGATTCAAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028170    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146250.1-1340s1c1
Sequence:CCGGCCTTTCAGATTAGGTTGCATTCTCGAGAATGCAACCTAATCTGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146250.1-543s21c1
Sequence:CCGGGTGGCTCTGCAAGGTTAATTCCTCGAGGAATTAACCTTGCAGAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422939    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146250.1-1420s21c1
Sequence:CCGGGATTTCTTCCCTGCAATTTAACTCGAGTTAAATTGCAGGGAAGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146250.1-266s21c1
Sequence:CCGGATTCCTATGCCTTAGATTATTCTCGAGAATAATCTAAGGCATAGGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005279
VALIDATED
GPR1 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005279.2-1045s1c1
Sequence:CCGGCCATCCTTTATGTCCTAATTACTCGAGTAATTAGGACATAAAGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005279.2-467s1c1
Sequence:CCGGGCTGTGCAAAGCCAATTCCTTCTCGAGAAGGAATTGGCTTTGCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005279.2-567s1c1
Sequence:CCGGCCTGTCTTATCTCATCGGCATCTCGAGATGCCGATGAGATAAGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005279.2-794s1c1
Sequence:CCGGCCCTTTGCTAACAATGAGTATCTCGAGATACTCATTGTTAGCAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005279.2-1303s1c1
Sequence:CCGGCGACTCCACTTTCATAGTTATCTCGAGATAACTATGAAAGTGGAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005279.3-430s21c1
Sequence:CCGGATTCCTATGACCTAGACTATTCTCGAGAATAGTCTAGGTCATAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357092    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005279.3-1680s21c1
Sequence:CCGGTTAGGAAGGATCCGCATAATTCTCGAGAATTATGCGGATCCTTCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005279.3-1577s21c1
Sequence:CCGGCACTATATAGGCATCACATTTCTCGAGAAATGTGATGCCTATATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005279
VALIDATED
GPR1 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005279.2-1045s1c1
Sequence:CCGGCCATCCTTTATGTCCTAATTACTCGAGTAATTAGGACATAAAGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005279.2-467s1c1
Sequence:CCGGGCTGTGCAAAGCCAATTCCTTCTCGAGAAGGAATTGGCTTTGCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005279.2-567s1c1
Sequence:CCGGCCTGTCTTATCTCATCGGCATCTCGAGATGCCGATGAGATAAGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005279.2-794s1c1
Sequence:CCGGCCCTTTGCTAACAATGAGTATCTCGAGATACTCATTGTTAGCAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005279.2-1303s1c1
Sequence:CCGGCGACTCCACTTTCATAGTTATCTCGAGATAACTATGAAAGTGGAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005279.3-430s21c1
Sequence:CCGGATTCCTATGACCTAGACTATTCTCGAGAATAGTCTAGGTCATAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357092    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005279.3-1680s21c1
Sequence:CCGGTTAGGAAGGATCCGCATAATTCTCGAGAATTATGCGGATCCTTCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005279.3-1577s21c1
Sequence:CCGGCACTATATAGGCATCACATTTCTCGAGAAATGTGATGCCTATATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005279
VALIDATED
GPR1 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005279.2-1045s1c1
Sequence:CCGGCCATCCTTTATGTCCTAATTACTCGAGTAATTAGGACATAAAGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005279.2-467s1c1
Sequence:CCGGGCTGTGCAAAGCCAATTCCTTCTCGAGAAGGAATTGGCTTTGCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005279.2-567s1c1
Sequence:CCGGCCTGTCTTATCTCATCGGCATCTCGAGATGCCGATGAGATAAGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005279.2-794s1c1
Sequence:CCGGCCCTTTGCTAACAATGAGTATCTCGAGATACTCATTGTTAGCAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005279.2-1303s1c1
Sequence:CCGGCGACTCCACTTTCATAGTTATCTCGAGATAACTATGAAAGTGGAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005279.3-430s21c1
Sequence:CCGGATTCCTATGACCTAGACTATTCTCGAGAATAGTCTAGGTCATAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357092    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005279.3-1680s21c1
Sequence:CCGGTTAGGAAGGATCCGCATAATTCTCGAGAATTATGCGGATCCTTCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005279.3-1577s21c1
Sequence:CCGGCACTATATAGGCATCACATTTCTCGAGAAATGTGATGCCTATATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks