EMAIL THIS PAGE TO A FRIEND

GPR20

G protein-coupled receptor 20

UniProtKB ID: Q99678, Q17R96
Gene ID:
Mouse(239530) G protein-coupled receptor 20
Rat(60667) G protein-coupled receptor 20
sheep(101118366) G protein-coupled receptor 20
domestic guinea pig(100722367) G protein-coupled receptor 20
naked mole-rat(101708005) G protein-coupled receptor 20
chicken(428381) G protein-coupled receptor 20
cow(515695) G protein-coupled receptor 20
domestic cat(101085691) G protein-coupled receptor 20
dog(482061) G protein-coupled receptor 20
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005293 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005293 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005293 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173365 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173365 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173365 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005293 Rosetta Predictions human pricing
NM_022216 Rosetta Predictions rat pricing
NM_173365 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005293 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054482 predicted 376
2 SASI_Hs01_00054484 predicted 725
3 SASI_Hs02_00339346 predicted 347
4 SASI_Hs01_00054485 predicted 734
5 SASI_Hs01_00054486 predicted 338
6 SASI_Hs02_00339347 predicted 468
7 SASI_Hs02_00339348 predicted 470
8 SASI_Hs01_00054489 predicted 336
9 SASI_Hs02_00339349 predicted 719
10 SASI_Hs02_00339350 predicted 708
11 SASI_Hs01_00054483 predicted 1144
12 SASI_Hs01_00054487 predicted 1299
13 SASI_Hs01_00054488 predicted 1297
14 SASI_Hs01_00054490 predicted 1142
15 SASI_Hs01_00054491 predicted 1242
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022216 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085750 predicted 617
2 SASI_Rn01_00085752 predicted 383
3 SASI_Rn01_00085753 predicted 245
4 SASI_Rn01_00085754 predicted 421
5 SASI_Rn01_00085755 predicted 571
6 SASI_Rn01_00085756 predicted 653
7 SASI_Rn01_00085757 predicted 526
8 SASI_Rn02_00262974 predicted 803
9 SASI_Rn01_00085758 predicted 247
10 SASI_Rn01_00085759 predicted 580
11 SASI_Rn01_00085751 predicted 578
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173365 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035208 predicted 1166
2 SASI_Mm01_00035209 predicted 588
3 SASI_Mm01_00035210 predicted 776
4 SASI_Mm01_00035211 predicted 1562
5 SASI_Mm01_00035212 predicted 839
6 SASI_Mm01_00035214 predicted 1287
7 SASI_Mm02_00345176 predicted 940
8 SASI_Mm01_00035215 predicted 1372
9 SASI_Mm01_00035216 predicted 1360
10 SASI_Mm01_00035217 predicted 363
11 SASI_Mm01_00035213 predicted 1164
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005293
GPR20 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 20
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005293.1-260s1c1
Sequence:CCGGCCTCAGTCATCTACACCATCACTCGAGTGATGGTGTAGATGACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005293.1-626s1c1
Sequence:CCGGTGCTGGTCATCAGCGTGTTTACTCGAGTAAACACGCTGATGACCAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005293.1-384s1c1
Sequence:CCGGCGGTTACTTCCTCAACATGCACTCGAGTGCATGTTGAGGAAGTAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005293.1-730s1c1
Sequence:CCGGCTCACGGTGCTCATCATCTTTCTCGAGAAAGATGATGAGCACCGTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367794    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005293.2-1309s21c1
Sequence:CCGGCCACTGTGCTGTGGTTGATTACTCGAGTAATCAACCACAGCACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357205    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005293.2-1250s21c1
Sequence:CCGGCGGTTCCATCTCGATTGATTGCTCGAGCAATCAATCGAGATGGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005293.2-820s21c1
Sequence:CCGGTCACGGTGCTCATCATCTTTCCTCGAGGAAAGATGATGAGCACCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005293.2-343s21c1
Sequence:CCGGAGACACCCTCAGTCATCTACACTCGAGTGTAGATGACTGAGGGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005293.2-147s21c1
Sequence:CCGGGTGACAACAGTGCGGACCAATCTCGAGATTGGTCCGCACTGTTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005293
GPR20 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 20
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005293.1-260s1c1
Sequence:CCGGCCTCAGTCATCTACACCATCACTCGAGTGATGGTGTAGATGACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005293.1-626s1c1
Sequence:CCGGTGCTGGTCATCAGCGTGTTTACTCGAGTAAACACGCTGATGACCAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005293.1-384s1c1
Sequence:CCGGCGGTTACTTCCTCAACATGCACTCGAGTGCATGTTGAGGAAGTAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005293.1-730s1c1
Sequence:CCGGCTCACGGTGCTCATCATCTTTCTCGAGAAAGATGATGAGCACCGTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367794    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005293.2-1309s21c1
Sequence:CCGGCCACTGTGCTGTGGTTGATTACTCGAGTAATCAACCACAGCACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357205    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005293.2-1250s21c1
Sequence:CCGGCGGTTCCATCTCGATTGATTGCTCGAGCAATCAATCGAGATGGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005293.2-820s21c1
Sequence:CCGGTCACGGTGCTCATCATCTTTCCTCGAGGAAAGATGATGAGCACCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005293.2-343s21c1
Sequence:CCGGAGACACCCTCAGTCATCTACACTCGAGTGTAGATGACTGAGGGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005293.2-147s21c1
Sequence:CCGGGTGACAACAGTGCGGACCAATCTCGAGATTGGTCCGCACTGTTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005293
GPR20 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 20
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005293.1-260s1c1
Sequence:CCGGCCTCAGTCATCTACACCATCACTCGAGTGATGGTGTAGATGACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005293.1-626s1c1
Sequence:CCGGTGCTGGTCATCAGCGTGTTTACTCGAGTAAACACGCTGATGACCAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005293.1-384s1c1
Sequence:CCGGCGGTTACTTCCTCAACATGCACTCGAGTGCATGTTGAGGAAGTAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005293.1-730s1c1
Sequence:CCGGCTCACGGTGCTCATCATCTTTCTCGAGAAAGATGATGAGCACCGTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367794    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005293.2-1309s21c1
Sequence:CCGGCCACTGTGCTGTGGTTGATTACTCGAGTAATCAACCACAGCACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357205    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005293.2-1250s21c1
Sequence:CCGGCGGTTCCATCTCGATTGATTGCTCGAGCAATCAATCGAGATGGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005293.2-820s21c1
Sequence:CCGGTCACGGTGCTCATCATCTTTCCTCGAGGAAAGATGATGAGCACCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005293.2-343s21c1
Sequence:CCGGAGACACCCTCAGTCATCTACACTCGAGTGTAGATGACTGAGGGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005293.2-147s21c1
Sequence:CCGGGTGACAACAGTGCGGACCAATCTCGAGATTGGTCCGCACTGTTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173365
GPR20 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 20
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173365.1-525s1c1
Sequence:CCGGCACACGCTTTGCTGTCTTCTACTCGAGTAGAAGACAGCAAAGCGTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173365.1-597s1c1
Sequence:CCGGCCTCAACATGCACTGTTCCATCTCGAGATGGAACAGTGCATGTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173365.1-424s1c1
Sequence:CCGGGCACTGTATGTCTTCTGCTGTCTCGAGACAGCAGAAGACATACAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173365.1-1245s1c1
Sequence:CCGGCCACACCCTTACCCAGCCTTTCTCGAGAAAGGCTGGGTAAGGGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173365.1-1002s1c1
Sequence:CCGGACTGTGGCCTAACGTACCTAACTCGAGTTAGGTACGTTAGGCCACAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173365
GPR20 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 20
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173365.1-525s1c1
Sequence:CCGGCACACGCTTTGCTGTCTTCTACTCGAGTAGAAGACAGCAAAGCGTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173365.1-597s1c1
Sequence:CCGGCCTCAACATGCACTGTTCCATCTCGAGATGGAACAGTGCATGTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173365.1-424s1c1
Sequence:CCGGGCACTGTATGTCTTCTGCTGTCTCGAGACAGCAGAAGACATACAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173365.1-1245s1c1
Sequence:CCGGCCACACCCTTACCCAGCCTTTCTCGAGAAAGGCTGGGTAAGGGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173365.1-1002s1c1
Sequence:CCGGACTGTGGCCTAACGTACCTAACTCGAGTTAGGTACGTTAGGCCACAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173365
GPR20 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 20
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173365.1-525s1c1
Sequence:CCGGCACACGCTTTGCTGTCTTCTACTCGAGTAGAAGACAGCAAAGCGTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173365.1-597s1c1
Sequence:CCGGCCTCAACATGCACTGTTCCATCTCGAGATGGAACAGTGCATGTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173365.1-424s1c1
Sequence:CCGGGCACTGTATGTCTTCTGCTGTCTCGAGACAGCAGAAGACATACAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173365.1-1245s1c1
Sequence:CCGGCCACACCCTTACCCAGCCTTTCTCGAGAAAGGCTGGGTAAGGGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173365.1-1002s1c1
Sequence:CCGGACTGTGGCCTAACGTACCTAACTCGAGTTAGGTACGTTAGGCCACAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks