EMAIL THIS PAGE TO A FRIEND

GPR21

G protein-coupled receptor 21

50 Gene Product Result for
UniProtKB ID: Q99679, B2R8W9, Q6NXU2
Gene ID:
Human(2844) Summary: This gene encodes a member of the G-protein-coupled receptor 1 family. G-protein coupled receptors are membrane proteins which activate signaling cascades as a response to extracellular stress. The encoded protein activates a Gq signal transduction pathway which mobilizes calcium. [provided by RefSeq, Nov 2012]
Mouse(338346) G protein-coupled receptor 21
Rat(689917) G protein-coupled receptor 21
chicken(772385) G protein-coupled receptor 21
cow(519193) G protein-coupled receptor 21
Horse(100067407) G protein-coupled receptor 21
domestic cat(101101677) G protein-coupled receptor 21
dog(612859) G protein-coupled receptor 21
domestic guinea pig(100713104) G protein-coupled receptor 21
naked mole-rat(101724310) G protein-coupled receptor 21
sheep(101109948) G protein-coupled receptor 21
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005294 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005294 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005294 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177383 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177383 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177383 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005294 Rosetta Predictions human pricing
NM_001109554 Rosetta Predictions rat pricing
NM_177383 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005294 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149534 predicted 757
2 SASI_Hs01_00149535 predicted 359
3 SASI_Hs01_00149536 predicted 741
4 SASI_Hs01_00149537 predicted 742
5 SASI_Hs01_00149538 predicted 370
6 SASI_Hs01_00149539 predicted 430
7 SASI_Hs01_00149541 predicted 611
8 SASI_Hs01_00149542 predicted 505
9 SASI_Hs01_00149543 predicted 653
10 SASI_Hs02_00339351 predicted 451
11 SASI_Hs01_00149540 predicted 561
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109554 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249539 predicted 806
2 SASI_Rn02_00249540 predicted 1104
3 SASI_Rn02_00249541 predicted 1513
4 SASI_Rn02_00249542 predicted 1487
5 SASI_Rn02_00249543 predicted 596
6 SASI_Rn02_00249544 predicted 1004
7 SASI_Rn02_00249545 predicted 652
8 SASI_Rn02_00249546 predicted 1246
9 SASI_Rn02_00249547 predicted 996
10 SASI_Rn02_00249548 predicted 934
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177383 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187188 predicted 844
2 SASI_Mm01_00187189 predicted 638
3 SASI_Mm01_00187190 predicted 833
4 SASI_Mm01_00187191 predicted 724
5 SASI_Mm01_00187192 predicted 970
6 SASI_Mm02_00347559 predicted 1256
7 SASI_Mm01_00187193 predicted 630
8 SASI_Mm01_00187194 predicted 1314
9 SASI_Mm01_00187195 predicted 551
10 SASI_Mm01_00187197 predicted 883
11 SASI_Mm01_00187196 predicted 1192
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005294
GPR21 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 21
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005294.1-295s21c1
Sequence:CCGGTCCTTGACTTGCCAGATATTTCTCGAGAAATATCTGGCAAGTCAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005294.1-615s21c1
Sequence:CCGGTATTGTCTGCTTCACCTATTTCTCGAGAAATAGGTGAAGCAGACAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005294.1-379s21c1
Sequence:CCGGAGATACATTGCCATTACTAAACTCGAGTTTAGTAATGGCAATGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005294.1-45s1c1
Sequence:CCGGCCTCTTGGCATTTGGCTATTTCTCGAGAAATAGCCAAATGCCAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005294.1-873s1c1
Sequence:CCGGGCTTGCTATTAGTAACAGTTTCTCGAGAAACTGTTACTAATAGCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005294.1-798s1c1
Sequence:CCGGGCCATATATCATCTACTTCTTCTCGAGAAGAAGTAGATGATATATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005294.1-654s1c1
Sequence:CCGGCCAACAGCACACAAAGGATATCTCGAGATATCCTTTGTGTGCTGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005294.1-384s1c1
Sequence:CCGGCATTGCCATTACTAAACCTTTCTCGAGAAAGGTTTAGTAATGGCAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005294
GPR21 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 21
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005294.1-295s21c1
Sequence:CCGGTCCTTGACTTGCCAGATATTTCTCGAGAAATATCTGGCAAGTCAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005294.1-615s21c1
Sequence:CCGGTATTGTCTGCTTCACCTATTTCTCGAGAAATAGGTGAAGCAGACAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005294.1-379s21c1
Sequence:CCGGAGATACATTGCCATTACTAAACTCGAGTTTAGTAATGGCAATGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005294.1-45s1c1
Sequence:CCGGCCTCTTGGCATTTGGCTATTTCTCGAGAAATAGCCAAATGCCAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005294.1-873s1c1
Sequence:CCGGGCTTGCTATTAGTAACAGTTTCTCGAGAAACTGTTACTAATAGCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005294.1-798s1c1
Sequence:CCGGGCCATATATCATCTACTTCTTCTCGAGAAGAAGTAGATGATATATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005294.1-654s1c1
Sequence:CCGGCCAACAGCACACAAAGGATATCTCGAGATATCCTTTGTGTGCTGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005294.1-384s1c1
Sequence:CCGGCATTGCCATTACTAAACCTTTCTCGAGAAAGGTTTAGTAATGGCAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005294
GPR21 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 21
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005294.1-295s21c1
Sequence:CCGGTCCTTGACTTGCCAGATATTTCTCGAGAAATATCTGGCAAGTCAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005294.1-615s21c1
Sequence:CCGGTATTGTCTGCTTCACCTATTTCTCGAGAAATAGGTGAAGCAGACAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005294.1-379s21c1
Sequence:CCGGAGATACATTGCCATTACTAAACTCGAGTTTAGTAATGGCAATGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005294.1-45s1c1
Sequence:CCGGCCTCTTGGCATTTGGCTATTTCTCGAGAAATAGCCAAATGCCAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005294.1-873s1c1
Sequence:CCGGGCTTGCTATTAGTAACAGTTTCTCGAGAAACTGTTACTAATAGCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005294.1-798s1c1
Sequence:CCGGGCCATATATCATCTACTTCTTCTCGAGAAGAAGTAGATGATATATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005294.1-654s1c1
Sequence:CCGGCCAACAGCACACAAAGGATATCTCGAGATATCCTTTGTGTGCTGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005294.1-384s1c1
Sequence:CCGGCATTGCCATTACTAAACCTTTCTCGAGAAAGGTTTAGTAATGGCAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177383
GPR21 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 21
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177383.2-554s1c1
Sequence:CCGGGTGCTGATTATTGTCTTTCTACTCGAGTAGAAAGACAATAATCAGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177383.2-1462s1c1
Sequence:CCGGCCCTTACACAGTTAGGTGCAACTCGAGTTGCACCTAACTGTGTAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177383.2-712s1c1
Sequence:CCGGCCCTTCCTTATCACTCCTCTACTCGAGTAGAGGAGTGATAAGGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177383.2-1258s1c1
Sequence:CCGGGCCATACATCATCTACTTCTTCTCGAGAAGAAGTAGATGATGTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177383.2-1030s1c1
Sequence:CCGGCTTCACATTGTTCATCGTGATCTCGAGATCACGATGAACAATGTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177383
GPR21 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 21
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177383.2-554s1c1
Sequence:CCGGGTGCTGATTATTGTCTTTCTACTCGAGTAGAAAGACAATAATCAGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177383.2-1462s1c1
Sequence:CCGGCCCTTACACAGTTAGGTGCAACTCGAGTTGCACCTAACTGTGTAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177383.2-712s1c1
Sequence:CCGGCCCTTCCTTATCACTCCTCTACTCGAGTAGAGGAGTGATAAGGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177383.2-1258s1c1
Sequence:CCGGGCCATACATCATCTACTTCTTCTCGAGAAGAAGTAGATGATGTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177383.2-1030s1c1
Sequence:CCGGCTTCACATTGTTCATCGTGATCTCGAGATCACGATGAACAATGTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177383
GPR21 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 21
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177383.2-554s1c1
Sequence:CCGGGTGCTGATTATTGTCTTTCTACTCGAGTAGAAAGACAATAATCAGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177383.2-1462s1c1
Sequence:CCGGCCCTTACACAGTTAGGTGCAACTCGAGTTGCACCTAACTGTGTAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177383.2-712s1c1
Sequence:CCGGCCCTTCCTTATCACTCCTCTACTCGAGTAGAGGAGTGATAAGGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177383.2-1258s1c1
Sequence:CCGGGCCATACATCATCTACTTCTTCTCGAGAAGAAGTAGATGATGTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177383.2-1030s1c1
Sequence:CCGGCTTCACATTGTTCATCGTGATCTCGAGATCACGATGAACAATGTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks