EMAIL THIS PAGE TO A FRIEND

GPR22

G protein-coupled receptor 22

74 Gene Product Result for
UniProtKB ID: Q99680, O14554
Gene ID:
Human(2845) Summary: This gene is a member of the G-protein coupled receptor 1 family and encodes a multi-pass membrane protein. [provided by RefSeq, Jul 2008]
Mouse(73010) G protein-coupled receptor 22
Rat(298944) G protein-coupled receptor 22
sheep(101103715) G protein-coupled receptor 22
domestic guinea pig(100724570) G protein-coupled receptor 22
naked mole-rat(101704863) G protein-coupled receptor 22
Zebrafish(504167) G protein-coupled receptor 22
cow(783685) G protein-coupled receptor 22
Horse(100146673) G protein-coupled receptor 22
domestic cat(101095564) G protein-coupled receptor 22
dog(607459) G protein-coupled receptor 22
chicken(769379) G protein-coupled receptor 22
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005295 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005295 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005295 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175191 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175191 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175191 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005295 Rosetta Predictions human pricing
NM_001106722 Rosetta Predictions rat pricing
NM_175191 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005295 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339352 predicted 2665
2 SASI_Hs01_00018224 predicted 2127
3 SASI_Hs01_00018225 predicted 1424
4 SASI_Hs01_00018226 predicted 2401
5 SASI_Hs01_00018227 predicted 2431
6 SASI_Hs01_00018228 predicted 1413
7 SASI_Hs01_00018229 predicted 2157
8 SASI_Hs01_00018230 predicted 1446
9 SASI_Hs01_00018232 predicted 1440
10 SASI_Hs01_00018233 predicted 2421
11 SASI_Hs01_00018231 predicted 1597
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106722 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221748 predicted 1829
2 SASI_Rn02_00221749 predicted 2471
3 SASI_Rn02_00221750 predicted 2114
4 SASI_Rn02_00221751 predicted 2461
5 SASI_Rn02_00221752 predicted 2265
6 SASI_Rn02_00221753 predicted 2593
7 SASI_Rn02_00221754 predicted 1510
8 SASI_Rn02_00221755 predicted 1892
9 SASI_Rn02_00221756 predicted 1692
10 SASI_Rn02_00221757 predicted 1648
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175191 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130254 predicted 2395
2 SASI_Mm01_00130255 predicted 1495
3 SASI_Mm01_00130256 predicted 1980
4 SASI_Mm01_00130258 predicted 2445
5 SASI_Mm01_00130259 predicted 1806
6 SASI_Mm01_00130260 predicted 1755
7 SASI_Mm01_00130261 predicted 2451
8 SASI_Mm01_00130262 predicted 2753
9 SASI_Mm01_00130263 predicted 1605
10 SASI_Mm02_00345853 predicted 1676
11 SASI_Mm01_00130257 predicted 2578
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005295
GPR22 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 22
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005295.1-177s1c1
Sequence:CCGGCCTCACTGTATTGGTACTTTACTCGAGTAAAGTACCAATACAGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005295.1-403s1c1
Sequence:CCGGGCTATCACTTTGGACAGATATCTCGAGATATCTGTCCAAAGTGATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005295.1-289s1c1
Sequence:CCGGCCTCTAACTATAGTTATCCTTCTCGAGAAGGATAACTATAGTTAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005295.1-134s1c1
Sequence:CCGGCCGGATTTCTTATGTTAGAAACTCGAGTTTCTAACATAAGAAATCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005295.1-1076s1c1
Sequence:CCGGCAACTATATTTCACCCTCTATCTCGAGATAGAGGGTGAAATATAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005295.2-2424s21c1
Sequence:CCGGACTATATTTCACCCTCTATTACTCGAGTAATAGAGGGTGAAATATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005295.2-1986s21c1
Sequence:CCGGTTAGTACAGATCCCAATATTCCTCGAGGAATATTGGGATCTGTACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005295.2-1434s21c1
Sequence:CCGGATGTACCAACCACTATCATATCTCGAGATATGATAGTGGTTGGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005295.2-1544s21c1
Sequence:CCGGCTGCATGAAATCCAACTTAATCTCGAGATTAAGTTGGATTTCATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005295
GPR22 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 22
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005295.1-177s1c1
Sequence:CCGGCCTCACTGTATTGGTACTTTACTCGAGTAAAGTACCAATACAGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005295.1-403s1c1
Sequence:CCGGGCTATCACTTTGGACAGATATCTCGAGATATCTGTCCAAAGTGATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005295.1-289s1c1
Sequence:CCGGCCTCTAACTATAGTTATCCTTCTCGAGAAGGATAACTATAGTTAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005295.1-134s1c1
Sequence:CCGGCCGGATTTCTTATGTTAGAAACTCGAGTTTCTAACATAAGAAATCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005295.1-1076s1c1
Sequence:CCGGCAACTATATTTCACCCTCTATCTCGAGATAGAGGGTGAAATATAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005295.2-2424s21c1
Sequence:CCGGACTATATTTCACCCTCTATTACTCGAGTAATAGAGGGTGAAATATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005295.2-1986s21c1
Sequence:CCGGTTAGTACAGATCCCAATATTCCTCGAGGAATATTGGGATCTGTACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005295.2-1434s21c1
Sequence:CCGGATGTACCAACCACTATCATATCTCGAGATATGATAGTGGTTGGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005295.2-1544s21c1
Sequence:CCGGCTGCATGAAATCCAACTTAATCTCGAGATTAAGTTGGATTTCATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005295
GPR22 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 22
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005295.1-177s1c1
Sequence:CCGGCCTCACTGTATTGGTACTTTACTCGAGTAAAGTACCAATACAGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005295.1-403s1c1
Sequence:CCGGGCTATCACTTTGGACAGATATCTCGAGATATCTGTCCAAAGTGATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005295.1-289s1c1
Sequence:CCGGCCTCTAACTATAGTTATCCTTCTCGAGAAGGATAACTATAGTTAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005295.1-134s1c1
Sequence:CCGGCCGGATTTCTTATGTTAGAAACTCGAGTTTCTAACATAAGAAATCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005295.1-1076s1c1
Sequence:CCGGCAACTATATTTCACCCTCTATCTCGAGATAGAGGGTGAAATATAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005295.2-2424s21c1
Sequence:CCGGACTATATTTCACCCTCTATTACTCGAGTAATAGAGGGTGAAATATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005295.2-1986s21c1
Sequence:CCGGTTAGTACAGATCCCAATATTCCTCGAGGAATATTGGGATCTGTACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005295.2-1434s21c1
Sequence:CCGGATGTACCAACCACTATCATATCTCGAGATATGATAGTGGTTGGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005295.2-1544s21c1
Sequence:CCGGCTGCATGAAATCCAACTTAATCTCGAGATTAAGTTGGATTTCATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175191
GPR22 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 22
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175191.2-2575s1c1
Sequence:CCGGCCATGCCTAATAACGCTGTAACTCGAGTTACAGCGTTATTAGGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175191.2-1800s1c1
Sequence:CCGGGCTATTACTCTGGACAGATATCTCGAGATATCTGTCCAGAGTAATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175191.2-1454s1c1
Sequence:CCGGGCGAGATGACATTGATGACATCTCGAGATGTCATCAATGTCATCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175191.2-1583s1c1
Sequence:CCGGCCTGGTACTTTACTGCATGAACTCGAGTTCATGCAGTAAAGTACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175191.2-2398s1c1
Sequence:CCGGCCATTCTATGTTTAGGCCCAACTCGAGTTGGGCCTAAACATAGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175191
GPR22 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 22
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175191.2-2575s1c1
Sequence:CCGGCCATGCCTAATAACGCTGTAACTCGAGTTACAGCGTTATTAGGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175191.2-1800s1c1
Sequence:CCGGGCTATTACTCTGGACAGATATCTCGAGATATCTGTCCAGAGTAATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175191.2-1454s1c1
Sequence:CCGGGCGAGATGACATTGATGACATCTCGAGATGTCATCAATGTCATCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175191.2-1583s1c1
Sequence:CCGGCCTGGTACTTTACTGCATGAACTCGAGTTCATGCAGTAAAGTACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175191.2-2398s1c1
Sequence:CCGGCCATTCTATGTTTAGGCCCAACTCGAGTTGGGCCTAAACATAGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175191
GPR22 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 22
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175191.2-2575s1c1
Sequence:CCGGCCATGCCTAATAACGCTGTAACTCGAGTTACAGCGTTATTAGGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175191.2-1800s1c1
Sequence:CCGGGCTATTACTCTGGACAGATATCTCGAGATATCTGTCCAGAGTAATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175191.2-1454s1c1
Sequence:CCGGGCGAGATGACATTGATGACATCTCGAGATGTCATCAATGTCATCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175191.2-1583s1c1
Sequence:CCGGCCTGGTACTTTACTGCATGAACTCGAGTTCATGCAGTAAAGTACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175191.2-2398s1c1
Sequence:CCGGCCATTCTATGTTTAGGCCCAACTCGAGTTGGGCCTAAACATAGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks