EMAIL THIS PAGE TO A FRIEND

GPR25

G protein-coupled receptor 25

51 Gene Product Result for
UniProtKB ID: O00155, A0AVJ5
Gene ID:
Human(2848) Summary: This gene is intronless and encodes a member of the G-protein coupled receptor 1 family. G-protein coupled receptors are membrane proteins which activate signaling cascades as a response to extracellular stress. This gene has been linked to arterial stiffness. [provided by RefSeq, Nov 2012]
Mouse(383563) G protein-coupled receptor 25
Rat(363993) G protein-coupled receptor 25
chicken(770582) G protein-coupled receptor 25
domestic cat(101098111) G protein-coupled receptor 25
naked mole-rat(101697804) G protein-coupled receptor 25
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2900562 Anti-GPR25 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
SAB2900592 Anti-GPR25 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005298 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005298 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005298 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001101516 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001101516 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001101516 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005298 Rosetta Predictions human pricing
XM_001064036 Rosetta Predictions rat pricing
XM_344146 Rosetta Predictions rat pricing
XM_357126 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005298 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172163 predicted 710
2 SASI_Hs01_00172164 predicted 592
3 SASI_Hs01_00172165 predicted 452
4 SASI_Hs01_00172166 predicted 776
5 SASI_Hs01_00172167 predicted 777
6 SASI_Hs01_00172168 predicted 477
7 SASI_Hs01_00172169 predicted 737
8 SASI_Hs01_00172170 predicted 708
9 SASI_Hs01_00172171 predicted 694
10 SASI_Hs01_00172172 predicted 776
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064036 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00309122 predicted 276
2 SASI_Rn02_00309123 predicted 662
3 SASI_Rn02_00309124 predicted 415
4 SASI_Rn02_00309125 predicted 673
5 SASI_Rn02_00309126 predicted 472
6 SASI_Rn02_00309127 predicted 263
7 SASI_Rn02_00309128 predicted 633
8 SASI_Rn02_00309129 predicted 629
9 SASI_Rn02_00309130 predicted 391
10 SASI_Rn02_00309131 predicted 465
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344146 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396866 predicted 272
2 SASI_Rn02_00396867 predicted 662
3 SASI_Rn02_00396868 predicted 415
4 SASI_Rn02_00396869 predicted 669
5 SASI_Rn02_00396870 predicted 468
6 SASI_Rn02_00396871 predicted 265
7 SASI_Rn02_00396872 predicted 641
8 SASI_Rn02_00396873 predicted 623
9 SASI_Rn02_00396874 predicted 382
10 SASI_Rn02_00396875 predicted 466
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_357126 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00255596 predicted 734
2 SASI_Mm01_00255597 predicted 1229
3 SASI_Mm01_00255598 predicted 732
4 SASI_Mm01_00255599 predicted 735
5 SASI_Mm01_00255600 predicted 919
6 SASI_Mm01_00255601 predicted 530
7 SASI_Mm01_00255602 predicted 1122
8 SASI_Mm01_00255603 predicted 1145
9 SASI_Mm01_00255604 predicted 534
10 SASI_Mm01_00255605 predicted 894
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005298
GPR25 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 25
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005298.2-731s21c1
Sequence:CCGGGCATCATCTTCGCCATCGAGACTCGAGTCTCGATGGCGAAGATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005298.2-739s21c1
Sequence:CCGGTTCGCCATCGAGAGCACGTTTCTCGAGAAACGTGCTCTCGATGGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005298.2-656s21c1
Sequence:CCGGTCTTCTGCTACTGCCGCATCTCTCGAGAGATGCGGCAGTAGCAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005298.2-106s21c1
Sequence:CCGGCCCTACGGCTACGTCTACATCCTCGAGGATGTAGACGTAGCCGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005298.2-726s1c1
Sequence:CCGGGCTGCGCATCATCTTCGCCATCTCGAGATGGCGAAGATGATGCGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005298.2-216s1c1
Sequence:CCGGGCTGGTGGATACCTTCGTGCTCTCGAGAGCACGAAGGTATCCACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005298.2-909s1c1
Sequence:CCGGCCCGCTCATCTACCTCCTGCTCTCGAGAGCAGGAGGTAGATGAGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005298.2-714s1c1
Sequence:CCGGCCGGAGGAACTCGCTGCGCATCTCGAGATGCGCAGCGAGTTCCTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005298.2-317s1c1
Sequence:CCGGCGTTCGGCGATGGCCTCTGCACTCGAGTGCAGAGGCCATCGCCGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005298
GPR25 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 25
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005298.2-731s21c1
Sequence:CCGGGCATCATCTTCGCCATCGAGACTCGAGTCTCGATGGCGAAGATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005298.2-739s21c1
Sequence:CCGGTTCGCCATCGAGAGCACGTTTCTCGAGAAACGTGCTCTCGATGGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005298.2-656s21c1
Sequence:CCGGTCTTCTGCTACTGCCGCATCTCTCGAGAGATGCGGCAGTAGCAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005298.2-106s21c1
Sequence:CCGGCCCTACGGCTACGTCTACATCCTCGAGGATGTAGACGTAGCCGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005298.2-726s1c1
Sequence:CCGGGCTGCGCATCATCTTCGCCATCTCGAGATGGCGAAGATGATGCGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005298.2-216s1c1
Sequence:CCGGGCTGGTGGATACCTTCGTGCTCTCGAGAGCACGAAGGTATCCACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005298.2-909s1c1
Sequence:CCGGCCCGCTCATCTACCTCCTGCTCTCGAGAGCAGGAGGTAGATGAGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005298.2-714s1c1
Sequence:CCGGCCGGAGGAACTCGCTGCGCATCTCGAGATGCGCAGCGAGTTCCTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005298.2-317s1c1
Sequence:CCGGCGTTCGGCGATGGCCTCTGCACTCGAGTGCAGAGGCCATCGCCGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005298
GPR25 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 25
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005298.2-731s21c1
Sequence:CCGGGCATCATCTTCGCCATCGAGACTCGAGTCTCGATGGCGAAGATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005298.2-739s21c1
Sequence:CCGGTTCGCCATCGAGAGCACGTTTCTCGAGAAACGTGCTCTCGATGGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005298.2-656s21c1
Sequence:CCGGTCTTCTGCTACTGCCGCATCTCTCGAGAGATGCGGCAGTAGCAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005298.2-106s21c1
Sequence:CCGGCCCTACGGCTACGTCTACATCCTCGAGGATGTAGACGTAGCCGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005298.2-726s1c1
Sequence:CCGGGCTGCGCATCATCTTCGCCATCTCGAGATGGCGAAGATGATGCGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005298.2-216s1c1
Sequence:CCGGGCTGGTGGATACCTTCGTGCTCTCGAGAGCACGAAGGTATCCACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005298.2-909s1c1
Sequence:CCGGCCCGCTCATCTACCTCCTGCTCTCGAGAGCAGGAGGTAGATGAGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005298.2-714s1c1
Sequence:CCGGCCGGAGGAACTCGCTGCGCATCTCGAGATGCGCAGCGAGTTCCTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005298.2-317s1c1
Sequence:CCGGCGTTCGGCGATGGCCTCTGCACTCGAGTGCAGAGGCCATCGCCGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001101516
GPR25 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 25
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101516.1-913s21c1
Sequence:CCGGCTCCTGTTGGACCGCTCATTCCTCGAGGAATGAGCGGTCCAACAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101516.1-869s21c1
Sequence:CCGGCCTGCCTGGCTTTCGTCAATACTCGAGTATTGACGAAAGCCAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101516.1-711s21c1
Sequence:CCGGCAACTCCCTGCGCATCATCTTCTCGAGAAGATGATGCGCAGGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101516.1-1637s21c1
Sequence:CCGGGTCATCACTATGTTATCTATACTCGAGTATAGATAACATAGTGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101516.1-36s21c1
Sequence:CCGGCACGTTGTCCTGGGACTATTCCTCGAGGAATAGTCCCAGGACAACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001101516
GPR25 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 25
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101516.1-913s21c1
Sequence:CCGGCTCCTGTTGGACCGCTCATTCCTCGAGGAATGAGCGGTCCAACAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101516.1-869s21c1
Sequence:CCGGCCTGCCTGGCTTTCGTCAATACTCGAGTATTGACGAAAGCCAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101516.1-711s21c1
Sequence:CCGGCAACTCCCTGCGCATCATCTTCTCGAGAAGATGATGCGCAGGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101516.1-1637s21c1
Sequence:CCGGGTCATCACTATGTTATCTATACTCGAGTATAGATAACATAGTGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101516.1-36s21c1
Sequence:CCGGCACGTTGTCCTGGGACTATTCCTCGAGGAATAGTCCCAGGACAACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001101516
GPR25 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 25
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101516.1-913s21c1
Sequence:CCGGCTCCTGTTGGACCGCTCATTCCTCGAGGAATGAGCGGTCCAACAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101516.1-869s21c1
Sequence:CCGGCCTGCCTGGCTTTCGTCAATACTCGAGTATTGACGAAAGCCAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101516.1-711s21c1
Sequence:CCGGCAACTCCCTGCGCATCATCTTCTCGAGAAGATGATGCGCAGGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101516.1-1637s21c1
Sequence:CCGGGTCATCACTATGTTATCTATACTCGAGTATAGATAACATAGTGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101516.1-36s21c1
Sequence:CCGGCACGTTGTCCTGGGACTATTCCTCGAGGAATAGTCCCAGGACAACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks