EMAIL THIS PAGE TO A FRIEND

GPR26

G protein-coupled receptor 26

95 Gene Product Result for
UniProtKB ID: Q8NDV2, Q2M2E2
Gene ID:
Mouse(233919) G protein-coupled receptor 26
Rat(192153) G protein-coupled receptor 26
sheep(101103363) G protein-coupled receptor 26
domestic guinea pig(100714539) G protein-coupled receptor 26
naked mole-rat(101697179) G protein-coupled receptor 26
chicken(423950) G protein-coupled receptor 26
cow(617411) G protein-coupled receptor 26
domestic cat(101097672) G protein-coupled receptor 26
dog(486926) G protein-coupled receptor 26
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173410 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173410 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173410 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153442 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153442 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153442 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU035751 MISSION® esiRNA esiRNA human GPR26 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153442 Rosetta Predictions human pricing
NM_138841 Rosetta Predictions rat pricing
NM_173410 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153442 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013094 predicted 1504
2 SASI_Hs01_00013095 predicted 422
3 SASI_Hs01_00013096 predicted 1074
4 SASI_Hs01_00013097 predicted 1020
5 SASI_Hs01_00013098 predicted 662
6 SASI_Hs01_00013099 predicted 331
7 SASI_Hs01_00013100 predicted 613
8 SASI_Hs01_00013101 predicted 1504
9 SASI_Hs01_00013102 predicted 291
10 SASI_Hs01_00013103 predicted 658
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138841 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090304 predicted 855
2 SASI_Rn01_00090305 predicted 302
3 SASI_Rn01_00090306 predicted 622
4 SASI_Rn01_00090308 predicted 643
5 SASI_Rn02_00268222 predicted 573
6 SASI_Rn01_00090309 predicted 689
7 SASI_Rn01_00090310 predicted 297
8 SASI_Rn01_00090312 predicted 549
9 SASI_Rn01_00090313 predicted 946
10 SASI_Rn02_00268223 predicted 767
11 SASI_Rn01_00090307 predicted 548
12 SASI_Rn01_00090311 predicted 933
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173410 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025769 predicted 1850
2 SASI_Mm01_00025770 predicted 1906
3 SASI_Mm02_00345277 predicted 1804
4 SASI_Mm01_00025771 predicted 1655
5 SASI_Mm01_00025772 predicted 1550
6 SASI_Mm02_00345278 predicted 1805
7 SASI_Mm01_00025773 predicted 920
8 SASI_Mm01_00025774 predicted 913
9 SASI_Mm01_00025775 predicted 1224
10 SASI_Mm01_00025776 predicted 1814
11 SASI_Mm01_00025767 predicted 1023
12 SASI_Mm01_00025768 predicted 1398
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173410
GPR26 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 26
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173410.1-1392s1c1
Sequence:CCGGGCTCCTGAACAGGATCTTCAACTCGAGTTGAAGATCCTGTTCAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173410.1-1222s1c1
Sequence:CCGGCTTGTGTGCTTTGCACCCTATCTCGAGATAGGGTGCAAAGCACACAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173410.1-1032s1c1
Sequence:CCGGGCTCTGCTTCACGTACCTCAACTCGAGTTGAGGTACGTGAAGCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173410.1-627s1c1
Sequence:CCGGCCTGCTGTGTACCGTGGTCAACTCGAGTTGACCACGGTACACAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173410.1-741s1c1
Sequence:CCGGCGCCAACTCCATGCTCAGCATCTCGAGATGCTGAGCATGGAGTTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173410
GPR26 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 26
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173410.1-1392s1c1
Sequence:CCGGGCTCCTGAACAGGATCTTCAACTCGAGTTGAAGATCCTGTTCAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173410.1-1222s1c1
Sequence:CCGGCTTGTGTGCTTTGCACCCTATCTCGAGATAGGGTGCAAAGCACACAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173410.1-1032s1c1
Sequence:CCGGGCTCTGCTTCACGTACCTCAACTCGAGTTGAGGTACGTGAAGCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173410.1-627s1c1
Sequence:CCGGCCTGCTGTGTACCGTGGTCAACTCGAGTTGACCACGGTACACAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173410.1-741s1c1
Sequence:CCGGCGCCAACTCCATGCTCAGCATCTCGAGATGCTGAGCATGGAGTTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173410
GPR26 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 26
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173410.1-1392s1c1
Sequence:CCGGGCTCCTGAACAGGATCTTCAACTCGAGTTGAAGATCCTGTTCAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173410.1-1222s1c1
Sequence:CCGGCTTGTGTGCTTTGCACCCTATCTCGAGATAGGGTGCAAAGCACACAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173410.1-1032s1c1
Sequence:CCGGGCTCTGCTTCACGTACCTCAACTCGAGTTGAGGTACGTGAAGCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173410.1-627s1c1
Sequence:CCGGCCTGCTGTGTACCGTGGTCAACTCGAGTTGACCACGGTACACAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173410.1-741s1c1
Sequence:CCGGCGCCAACTCCATGCTCAGCATCTCGAGATGCTGAGCATGGAGTTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153442
GPR26 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 26
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153442.1-818s1c1
Sequence:CCGGCCCTATGTGATCACCAGGCTACTCGAGTAGCCTGGTGATCACATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008864    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153442.1-4504s1c1
Sequence:CCGGCCTGAGTTTAATGAGGATATTCTCGAGAATATCCTCATTAAACTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153442.1-613s1c1
Sequence:CCGGGCTCTGCTGCACGTACCTCAACTCGAGTTGAGGTACGTGCAGCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153442.1-1027s1c1
Sequence:CCGGCGACTCTCACAGCCAGAACATCTCGAGATGTTCTGGCTGTGAGAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153442.1-649s1c1
Sequence:CCGGCCGCTTCCATTGCAAGCGCATCTCGAGATGCGCTTGCAATGGAAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153442.3-1241s21c1
Sequence:CCGGGATATTGGACACTCCTTATTTCTCGAGAAATAAGGAGTGTCCAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153442.3-1030s21c1
Sequence:CCGGACTCTCACAGCCAGAACATTCCTCGAGGAATGTTCTGGCTGTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153442.3-659s21c1
Sequence:CCGGTTGCAAGCGCATCGACGTGATCTCGAGATCACGTCGATGCGCTTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153442.3-775s21c1
Sequence:CCGGAGAAGATCAGCACCTTCATAGCTCGAGCTATGAAGGTGCTGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153442
GPR26 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 26
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153442.1-818s1c1
Sequence:CCGGCCCTATGTGATCACCAGGCTACTCGAGTAGCCTGGTGATCACATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008864    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153442.1-4504s1c1
Sequence:CCGGCCTGAGTTTAATGAGGATATTCTCGAGAATATCCTCATTAAACTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153442.1-613s1c1
Sequence:CCGGGCTCTGCTGCACGTACCTCAACTCGAGTTGAGGTACGTGCAGCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153442.1-1027s1c1
Sequence:CCGGCGACTCTCACAGCCAGAACATCTCGAGATGTTCTGGCTGTGAGAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153442.1-649s1c1
Sequence:CCGGCCGCTTCCATTGCAAGCGCATCTCGAGATGCGCTTGCAATGGAAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153442.3-1241s21c1
Sequence:CCGGGATATTGGACACTCCTTATTTCTCGAGAAATAAGGAGTGTCCAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153442.3-1030s21c1
Sequence:CCGGACTCTCACAGCCAGAACATTCCTCGAGGAATGTTCTGGCTGTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153442.3-659s21c1
Sequence:CCGGTTGCAAGCGCATCGACGTGATCTCGAGATCACGTCGATGCGCTTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153442.3-775s21c1
Sequence:CCGGAGAAGATCAGCACCTTCATAGCTCGAGCTATGAAGGTGCTGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153442
GPR26 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 26
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153442.1-818s1c1
Sequence:CCGGCCCTATGTGATCACCAGGCTACTCGAGTAGCCTGGTGATCACATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008864    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153442.1-4504s1c1
Sequence:CCGGCCTGAGTTTAATGAGGATATTCTCGAGAATATCCTCATTAAACTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153442.1-613s1c1
Sequence:CCGGGCTCTGCTGCACGTACCTCAACTCGAGTTGAGGTACGTGCAGCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153442.1-1027s1c1
Sequence:CCGGCGACTCTCACAGCCAGAACATCTCGAGATGTTCTGGCTGTGAGAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153442.1-649s1c1
Sequence:CCGGCCGCTTCCATTGCAAGCGCATCTCGAGATGCGCTTGCAATGGAAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153442.3-1241s21c1
Sequence:CCGGGATATTGGACACTCCTTATTTCTCGAGAAATAAGGAGTGTCCAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153442.3-1030s21c1
Sequence:CCGGACTCTCACAGCCAGAACATTCCTCGAGGAATGTTCTGGCTGTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153442.3-659s21c1
Sequence:CCGGTTGCAAGCGCATCGACGTGATCTCGAGATCACGTCGATGCGCTTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153442.3-775s21c1
Sequence:CCGGAGAAGATCAGCACCTTCATAGCTCGAGCTATGAAGGTGCTGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks