EMAIL THIS PAGE TO A FRIEND

GPR27

G protein-coupled receptor 27

48 Gene Product Result for
Synonyms: SREB1
UniProtKB ID: Q9NS67
Gene ID:
Human(2850) Summary: GPR27 is a member of the G protein-coupled receptors (GPCRs), a large family of receptors that have a similar structure characterized by 7 transmembrane domains. Activation of GPCRs by extracellular stimuli such as neurotransmitters, hormones, or light induces an intracellular signaling cascade mediated by heterotrimeric GTP-binding proteins, or G proteins.[supplied by OMIM, May 2010]
Mouse(14761) G protein-coupled receptor 27
Rat(65275) G protein-coupled receptor 27
Zebrafish(567355) G protein-coupled receptor 27
chicken(416094) G protein-coupled receptor 27
cow(782069) G protein-coupled receptor 27
dog(100687908) G protein-coupled receptor 27
domestic guinea pig(100728722) G protein-coupled receptor 27
naked mole-rat(101723376) G protein-coupled receptor 27
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018971 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018971 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018971 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008158 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008158 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008158 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018971 Rosetta Predictions human pricing
NM_023099 Rosetta Predictions rat pricing
NM_008158 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018971 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224965 predicted 500
2 SASI_Hs01_00224966 predicted 148
3 SASI_Hs01_00224967 predicted 831
4 SASI_Hs01_00224968 predicted 1006
5 SASI_Hs01_00224969 predicted 893
6 SASI_Hs01_00224970 predicted 1025
7 SASI_Hs01_00224971 predicted 1091
8 SASI_Hs01_00224972 predicted 117
9 SASI_Hs01_00224973 predicted 107
10 SASI_Hs01_00224974 predicted 288
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023099 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048718 predicted 283
2 SASI_Rn01_00048719 predicted 834
3 SASI_Rn01_00048720 predicted 839
4 SASI_Rn01_00048721 predicted 900
5 SASI_Rn01_00048722 predicted 594
6 SASI_Rn01_00048723 predicted 205
7 SASI_Rn01_00048724 predicted 892
8 SASI_Rn01_00048726 predicted 900
9 SASI_Rn01_00048727 predicted 723
10 SASI_Rn02_00263738 predicted 847
11 SASI_Rn01_00048725 predicted 328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008158 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082975 predicted 840
2 SASI_Mm01_00082976 predicted 849
3 SASI_Mm01_00082977 predicted 812
4 SASI_Mm01_00082978 predicted 764
5 SASI_Mm01_00082979 predicted 613
6 SASI_Mm01_00082980 predicted 595
7 SASI_Mm01_00082981 predicted 676
8 SASI_Mm01_00082982 predicted 659
9 SASI_Mm01_00082983 predicted 854
10 SASI_Mm01_00082984 predicted 606
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018971
GPR27 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 27
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018971.1-599s21c1
Sequence:CCGGTCTACCTCCGCCTGCTCTTCTCTCGAGAGAAGAGCAGGCGGAGGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018971.1-806s21c1
Sequence:CCGGGCCTCCTCGTGCTGGAAGAATCTCGAGATTCTTCCAGCACGAGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018971.1-849s21c1
Sequence:CCGGCAAGATGTTCTACGCCGTCACCTCGAGGTGACGGCGTAGAACATCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018971.1-159s21c1
Sequence:CCGGGTACTACCTGCTGCTCGACCTCTCGAGAGGTCGAGCAGCAGGTAGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018971.1-610s21c1
Sequence:CCGGCTGCTCTTCTTCATCCACGACCTCGAGGTCGTGGATGAAGAAGAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018971.1-370s21c1
Sequence:CCGGATCGCGCACCACCGCTTCTATCTCGAGATAGAAGCGGTGGTGCGCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018971.1-831s1c1
Sequence:CCGGGACGGAGAAGAGGCTGTGCAACTCGAGTTGCACAGCCTCTTCTCCGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018971.1-969s1c1
Sequence:CCGGCGTGTGGCTGACCTTCGCGCACTCGAGTGCGCGAAGGTCAGCCACACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018971.1-606s1c1
Sequence:CCGGCCGCCTGCTCTTCTTCATCCACTCGAGTGGATGAAGAAGAGCAGGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018971.1-810s1c1
Sequence:CCGGCCTCGTGCTGGAAGAATTCAACTCGAGTTGAATTCTTCCAGCACGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018971
GPR27 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 27
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018971.1-599s21c1
Sequence:CCGGTCTACCTCCGCCTGCTCTTCTCTCGAGAGAAGAGCAGGCGGAGGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018971.1-806s21c1
Sequence:CCGGGCCTCCTCGTGCTGGAAGAATCTCGAGATTCTTCCAGCACGAGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018971.1-849s21c1
Sequence:CCGGCAAGATGTTCTACGCCGTCACCTCGAGGTGACGGCGTAGAACATCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018971.1-159s21c1
Sequence:CCGGGTACTACCTGCTGCTCGACCTCTCGAGAGGTCGAGCAGCAGGTAGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018971.1-610s21c1
Sequence:CCGGCTGCTCTTCTTCATCCACGACCTCGAGGTCGTGGATGAAGAAGAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018971.1-370s21c1
Sequence:CCGGATCGCGCACCACCGCTTCTATCTCGAGATAGAAGCGGTGGTGCGCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018971.1-831s1c1
Sequence:CCGGGACGGAGAAGAGGCTGTGCAACTCGAGTTGCACAGCCTCTTCTCCGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018971.1-969s1c1
Sequence:CCGGCGTGTGGCTGACCTTCGCGCACTCGAGTGCGCGAAGGTCAGCCACACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018971.1-606s1c1
Sequence:CCGGCCGCCTGCTCTTCTTCATCCACTCGAGTGGATGAAGAAGAGCAGGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018971.1-810s1c1
Sequence:CCGGCCTCGTGCTGGAAGAATTCAACTCGAGTTGAATTCTTCCAGCACGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018971
GPR27 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 27
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018971.1-599s21c1
Sequence:CCGGTCTACCTCCGCCTGCTCTTCTCTCGAGAGAAGAGCAGGCGGAGGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018971.1-806s21c1
Sequence:CCGGGCCTCCTCGTGCTGGAAGAATCTCGAGATTCTTCCAGCACGAGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018971.1-849s21c1
Sequence:CCGGCAAGATGTTCTACGCCGTCACCTCGAGGTGACGGCGTAGAACATCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018971.1-159s21c1
Sequence:CCGGGTACTACCTGCTGCTCGACCTCTCGAGAGGTCGAGCAGCAGGTAGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018971.1-610s21c1
Sequence:CCGGCTGCTCTTCTTCATCCACGACCTCGAGGTCGTGGATGAAGAAGAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018971.1-370s21c1
Sequence:CCGGATCGCGCACCACCGCTTCTATCTCGAGATAGAAGCGGTGGTGCGCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018971.1-831s1c1
Sequence:CCGGGACGGAGAAGAGGCTGTGCAACTCGAGTTGCACAGCCTCTTCTCCGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018971.1-969s1c1
Sequence:CCGGCGTGTGGCTGACCTTCGCGCACTCGAGTGCGCGAAGGTCAGCCACACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018971.1-606s1c1
Sequence:CCGGCCGCCTGCTCTTCTTCATCCACTCGAGTGGATGAAGAAGAGCAGGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018971.1-810s1c1
Sequence:CCGGCCTCGTGCTGGAAGAATTCAACTCGAGTTGAATTCTTCCAGCACGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008158
GPR27 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 27
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008158.1-309s1c1
Sequence:CCGGCCTGGCCGCACTCTTCTGCTTCTCGAGAAGCAGAAGAGTGCGGCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008158.1-858s1c1
Sequence:CCGGGTGCAAGATGTTCTACGCCATCTCGAGATGGCGTAGAACATCTTGCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008158.1-117s1c1
Sequence:CCGGCGTGCTGTTCGCGCTGCTCATCTCGAGATGAGCAGCGCGAACAGCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008158.1-975s1c1
Sequence:CCGGAGCCTCGGTGTGGCTGACATTCTCGAGAATGTCAGCCACACCGAGGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008158.1-870s1c1
Sequence:CCGGCTACGCCATCACGCTGCTCTTCTCGAGAAGAGCAGCGTGATGGCGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008158
GPR27 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 27
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008158.1-309s1c1
Sequence:CCGGCCTGGCCGCACTCTTCTGCTTCTCGAGAAGCAGAAGAGTGCGGCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008158.1-858s1c1
Sequence:CCGGGTGCAAGATGTTCTACGCCATCTCGAGATGGCGTAGAACATCTTGCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008158.1-117s1c1
Sequence:CCGGCGTGCTGTTCGCGCTGCTCATCTCGAGATGAGCAGCGCGAACAGCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008158.1-975s1c1
Sequence:CCGGAGCCTCGGTGTGGCTGACATTCTCGAGAATGTCAGCCACACCGAGGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008158.1-870s1c1
Sequence:CCGGCTACGCCATCACGCTGCTCTTCTCGAGAAGAGCAGCGTGATGGCGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008158
GPR27 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 27
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008158.1-309s1c1
Sequence:CCGGCCTGGCCGCACTCTTCTGCTTCTCGAGAAGCAGAAGAGTGCGGCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008158.1-858s1c1
Sequence:CCGGGTGCAAGATGTTCTACGCCATCTCGAGATGGCGTAGAACATCTTGCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008158.1-117s1c1
Sequence:CCGGCGTGCTGTTCGCGCTGCTCATCTCGAGATGAGCAGCGCGAACAGCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008158.1-975s1c1
Sequence:CCGGAGCCTCGGTGTGGCTGACATTCTCGAGAATGTCAGCCACACCGAGGCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008158.1-870s1c1
Sequence:CCGGCTACGCCATCACGCTGCTCTTCTCGAGAAGAGCAGCGTGATGGCGTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)