EMAIL THIS PAGE TO A FRIEND

GPR31

G protein-coupled receptor 31

46 Gene Product Result for
Synonyms: 12-HETER HETER HETER1
UniProtKB ID: O00270, B0M0K2, Q4VBL3, Q9NQ20
Gene ID:
Mouse(107431) G protein-coupled receptor 31
Rat(292310) G protein-coupled receptor 31
cow(617303) G protein-coupled receptor 31
domestic cat(101080638) G protein-coupled receptor 31
dog(484081) G protein-coupled receptor 31
domestic guinea pig(100728685) G protein-coupled receptor 31
sheep(101115547) G protein-coupled receptor 31
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005299 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005299 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005299 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU136791 MISSION® esiRNA esiRNA human GPR31 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005299 Rosetta Predictions human pricing
XM_001070058 Rosetta Predictions rat pricing
XM_217867 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005299 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129056 predicted 356
2 SASI_Hs01_00129057 predicted 566
3 SASI_Hs01_00129058 predicted 479
4 SASI_Hs01_00129060 predicted 512
5 SASI_Hs01_00129061 predicted 719
6 SASI_Hs01_00129062 predicted 724
7 SASI_Hs01_00129063 predicted 530
8 SASI_Hs01_00129064 predicted 302
9 SASI_Hs02_00339355 predicted 270
10 SASI_Hs01_00129065 predicted 513
11 SASI_Hs01_00129059 predicted 532
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070058 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00330288 predicted 734
2 SASI_Rn02_00330289 predicted 456
3 SASI_Rn02_00330290 predicted 226
4 SASI_Rn02_00330291 predicted 414
5 SASI_Rn02_00330292 predicted 365
6 SASI_Rn02_00330293 predicted 373
7 SASI_Rn02_00330294 predicted 358
8 SASI_Rn02_00330295 predicted 684
9 SASI_Rn02_00330296 predicted 741
10 SASI_Rn02_00330297 predicted 361
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_217867 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377377 predicted 738
2 SASI_Rn02_00377378 predicted 461
3 SASI_Rn02_00377379 predicted 223
4 SASI_Rn02_00377380 predicted 417
5 SASI_Rn02_00377381 predicted 358
6 SASI_Rn02_00377382 predicted 375
7 SASI_Rn02_00377383 predicted 354
8 SASI_Rn02_00377384 predicted 681
9 SASI_Rn02_00377385 predicted 747
10 SASI_Rn02_00377386 predicted 360
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005299
GPR31 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 31
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005299.2-345s21c1
Sequence:CCGGTGTGGTCCACCCTCGGCTTAACTCGAGTTAAGCCGAGGGTGGACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005299.2-724s21c1
Sequence:CCGGAGAGTCCTGATGCACATCTTCCTCGAGGAAGATGTGCATCAGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005299.2-539s21c1
Sequence:CCGGCACTCTCCTGCCTTCAGTTTGCTCGAGCAAACTGAAGGCAGGAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005299.2-777s21c1
Sequence:CCGGAGTGGCTCATACCTCGGATGTCTCGAGACATCCGAGGTATGAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005299.2-507s21c1
Sequence:CCGGAGACGGCTCCTTCAGCATCATCTCGAGATGATGCTGAAGGAGCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005299.1-579s1c1
Sequence:CCGGCGTGTTCTGCAATGCAGGCATCTCGAGATGCCTGCATTGCAGAACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005299.1-723s1c1
Sequence:CCGGCAGAGTCCTGATGCACATCTTCTCGAGAAGATGTGCATCAGGACTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005299.1-343s1c1
Sequence:CCGGCGTGTGGTCCACCCTCGGCTTCTCGAGAAGCCGAGGGTGGACCACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005299.1-147s1c1
Sequence:CCGGCGCTGTCTACCTGCTCAACCTCTCGAGAGGTTGAGCAGGTAGACAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005299.1-775s1c1
Sequence:CCGGGCAGTGGCTCATACCTCGGATCTCGAGATCCGAGGTATGAGCCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005299
GPR31 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 31
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005299.2-345s21c1
Sequence:CCGGTGTGGTCCACCCTCGGCTTAACTCGAGTTAAGCCGAGGGTGGACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005299.2-724s21c1
Sequence:CCGGAGAGTCCTGATGCACATCTTCCTCGAGGAAGATGTGCATCAGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005299.2-539s21c1
Sequence:CCGGCACTCTCCTGCCTTCAGTTTGCTCGAGCAAACTGAAGGCAGGAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005299.2-777s21c1
Sequence:CCGGAGTGGCTCATACCTCGGATGTCTCGAGACATCCGAGGTATGAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005299.2-507s21c1
Sequence:CCGGAGACGGCTCCTTCAGCATCATCTCGAGATGATGCTGAAGGAGCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005299.1-579s1c1
Sequence:CCGGCGTGTTCTGCAATGCAGGCATCTCGAGATGCCTGCATTGCAGAACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005299.1-723s1c1
Sequence:CCGGCAGAGTCCTGATGCACATCTTCTCGAGAAGATGTGCATCAGGACTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005299.1-343s1c1
Sequence:CCGGCGTGTGGTCCACCCTCGGCTTCTCGAGAAGCCGAGGGTGGACCACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005299.1-147s1c1
Sequence:CCGGCGCTGTCTACCTGCTCAACCTCTCGAGAGGTTGAGCAGGTAGACAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005299.1-775s1c1
Sequence:CCGGGCAGTGGCTCATACCTCGGATCTCGAGATCCGAGGTATGAGCCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005299
GPR31 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 31
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005299.2-345s21c1
Sequence:CCGGTGTGGTCCACCCTCGGCTTAACTCGAGTTAAGCCGAGGGTGGACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005299.2-724s21c1
Sequence:CCGGAGAGTCCTGATGCACATCTTCCTCGAGGAAGATGTGCATCAGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005299.2-539s21c1
Sequence:CCGGCACTCTCCTGCCTTCAGTTTGCTCGAGCAAACTGAAGGCAGGAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005299.2-777s21c1
Sequence:CCGGAGTGGCTCATACCTCGGATGTCTCGAGACATCCGAGGTATGAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005299.2-507s21c1
Sequence:CCGGAGACGGCTCCTTCAGCATCATCTCGAGATGATGCTGAAGGAGCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005299.1-579s1c1
Sequence:CCGGCGTGTTCTGCAATGCAGGCATCTCGAGATGCCTGCATTGCAGAACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005299.1-723s1c1
Sequence:CCGGCAGAGTCCTGATGCACATCTTCTCGAGAAGATGTGCATCAGGACTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005299.1-343s1c1
Sequence:CCGGCGTGTGGTCCACCCTCGGCTTCTCGAGAAGCCGAGGGTGGACCACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005299.1-147s1c1
Sequence:CCGGCGCTGTCTACCTGCTCAACCTCTCGAGAGGTTGAGCAGGTAGACAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005299.1-775s1c1
Sequence:CCGGGCAGTGGCTCATACCTCGGATCTCGAGATCCGAGGTATGAGCCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks