EMAIL THIS PAGE TO A FRIEND

GPR32

G protein-coupled receptor 32

25 Gene Product Result for
Synonyms: RVDR1
UniProtKB ID: O75388, Q502U7, Q6NWS5
Gene ID:
Human(2854) Summary: This gene is intronless and encodes a member of the G-protein coupled receptor 1 family. The encoded protein binds to resolvin D1 and lipoxin A4 and has been linked to pulmonary inflammation. A related pseudogene has been identified on chromosome 19. [provided by RefSeq, Nov 2012]
sheep(101119331) G protein-coupled receptor 32
domestic guinea pig(100718187) G protein-coupled receptor 32
cow(617938) G protein-coupled receptor 32
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001506 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001506 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001506 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001506 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001506 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168072 predicted 379
2 SASI_Hs01_00168073 predicted 780
3 SASI_Hs01_00168074 predicted 268
4 SASI_Hs01_00168075 predicted 261
5 SASI_Hs01_00168079 predicted 267
6 SASI_Hs01_00168076 predicted 320
7 SASI_Hs01_00168080 predicted 525
8 SASI_Hs01_00168081 predicted 373
9 SASI_Hs02_00331997 predicted 408
10 SASI_Hs02_00331998 predicted 522
11 SASI_Hs01_00168077 predicted 585
12 SASI_Hs01_00168078 predicted 365
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001506
GPR32 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 32
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001506.1-66s1c1
Sequence:CCGGTCGCTCTTGTTCCAGGAAGATCTCGAGATCTTCCTGGAACAAGAGCGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001506.1-844s1c1
Sequence:CCGGCGACGGGTGATGCTCAAGGAACTCGAGTTCCTTGAGCATCACCCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001506.1-126s1c1
Sequence:CCGGCCGCCCACTGACTGTGGTTATCTCGAGATAACCACAGTCAGTGGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001506.1-576s1c1
Sequence:CCGGCTTGGCGTTCAACTCTGACAACTCGAGTTGTCAGAGTTGAACGCCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001506.1-366s1c1
Sequence:CCGGCCTCAGCTACTTTGCCAGTAACTCGAGTTACTGGCAAAGTAGCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001506.1-515s21c1
Sequence:CCGGTGTGCTCTGCGCACCTGAAATCTCGAGATTTCAGGTGCGCAGAGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001506.1-625s21c1
Sequence:CCGGGTCGTGGAGGGACACATTATACTCGAGTATAATGTGTCCCTCCACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001506.1-367s21c1
Sequence:CCGGCTCAGCTACTTTGCCAGTAACCTCGAGGTTACTGGCAAAGTAGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001506.1-578s21c1
Sequence:CCGGTGGCGTTCAACTCTGACAATGCTCGAGCATTGTCAGAGTTGAACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001506.1-142s21c1
Sequence:CCGGGTTATCCTGTCTGCGTCCATTCTCGAGAATGGACGCAGACAGGATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001506.1-286s21c1
Sequence:CCGGCCCATTGCCATGTACTATATTCTCGAGAATATAGTACATGGCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001506.1-846s21c1
Sequence:CCGGACGGGTGATGCTCAAGGAAATCTCGAGATTTCCTTGAGCATCACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001506.1-887s21c1
Sequence:CCGGTCATCCTCCAGGCTAGCTTTGCTCGAGCAAAGCTAGCCTGGAGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001506
GPR32 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 32
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001506.1-66s1c1
Sequence:CCGGTCGCTCTTGTTCCAGGAAGATCTCGAGATCTTCCTGGAACAAGAGCGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001506.1-844s1c1
Sequence:CCGGCGACGGGTGATGCTCAAGGAACTCGAGTTCCTTGAGCATCACCCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001506.1-126s1c1
Sequence:CCGGCCGCCCACTGACTGTGGTTATCTCGAGATAACCACAGTCAGTGGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001506.1-576s1c1
Sequence:CCGGCTTGGCGTTCAACTCTGACAACTCGAGTTGTCAGAGTTGAACGCCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001506.1-366s1c1
Sequence:CCGGCCTCAGCTACTTTGCCAGTAACTCGAGTTACTGGCAAAGTAGCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001506.1-515s21c1
Sequence:CCGGTGTGCTCTGCGCACCTGAAATCTCGAGATTTCAGGTGCGCAGAGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001506.1-625s21c1
Sequence:CCGGGTCGTGGAGGGACACATTATACTCGAGTATAATGTGTCCCTCCACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001506.1-367s21c1
Sequence:CCGGCTCAGCTACTTTGCCAGTAACCTCGAGGTTACTGGCAAAGTAGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001506.1-578s21c1
Sequence:CCGGTGGCGTTCAACTCTGACAATGCTCGAGCATTGTCAGAGTTGAACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001506.1-142s21c1
Sequence:CCGGGTTATCCTGTCTGCGTCCATTCTCGAGAATGGACGCAGACAGGATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001506.1-286s21c1
Sequence:CCGGCCCATTGCCATGTACTATATTCTCGAGAATATAGTACATGGCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001506.1-846s21c1
Sequence:CCGGACGGGTGATGCTCAAGGAAATCTCGAGATTTCCTTGAGCATCACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001506.1-887s21c1
Sequence:CCGGTCATCCTCCAGGCTAGCTTTGCTCGAGCAAAGCTAGCCTGGAGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001506
GPR32 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 32
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001506.1-66s1c1
Sequence:CCGGTCGCTCTTGTTCCAGGAAGATCTCGAGATCTTCCTGGAACAAGAGCGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001506.1-844s1c1
Sequence:CCGGCGACGGGTGATGCTCAAGGAACTCGAGTTCCTTGAGCATCACCCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001506.1-126s1c1
Sequence:CCGGCCGCCCACTGACTGTGGTTATCTCGAGATAACCACAGTCAGTGGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001506.1-576s1c1
Sequence:CCGGCTTGGCGTTCAACTCTGACAACTCGAGTTGTCAGAGTTGAACGCCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001506.1-366s1c1
Sequence:CCGGCCTCAGCTACTTTGCCAGTAACTCGAGTTACTGGCAAAGTAGCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001506.1-515s21c1
Sequence:CCGGTGTGCTCTGCGCACCTGAAATCTCGAGATTTCAGGTGCGCAGAGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001506.1-625s21c1
Sequence:CCGGGTCGTGGAGGGACACATTATACTCGAGTATAATGTGTCCCTCCACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001506.1-367s21c1
Sequence:CCGGCTCAGCTACTTTGCCAGTAACCTCGAGGTTACTGGCAAAGTAGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001506.1-578s21c1
Sequence:CCGGTGGCGTTCAACTCTGACAATGCTCGAGCATTGTCAGAGTTGAACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001506.1-142s21c1
Sequence:CCGGGTTATCCTGTCTGCGTCCATTCTCGAGAATGGACGCAGACAGGATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001506.1-286s21c1
Sequence:CCGGCCCATTGCCATGTACTATATTCTCGAGAATATAGTACATGGCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001506.1-846s21c1
Sequence:CCGGACGGGTGATGCTCAAGGAAATCTCGAGATTTCCTTGAGCATCACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001506.1-887s21c1
Sequence:CCGGTCATCCTCCAGGCTAGCTTTGCTCGAGCAAAGCTAGCCTGGAGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks